Dataset for CDS classical BH3-containing proteins of organism Macaca nemestrina

[Download (right click)] [Edit] [Sequences] [Repertoires]

22 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6BV75_PMAIP1-      atgc----------------------------ctgggaagaag-------
A0A2K6BV75_PMAIP1-      atgc----------------------------ctgggaagaag-------
A0A2K6DBJ4_BIK-01       atgt------------ctggagtaagacccatctccagagacaccttgat
A0A2K6AYL7_HRK-01       atgt-----------------gcccgtgccccctgca-------------
A0A2K6E226_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6E226_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6E226_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6E226_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6E226_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6E226_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6E226_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6E226_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6E226_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6E226_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6E7J3_BAD-02       atgttccag--a--tcccagagtttgagcctagtg--agcaggaaga---
A0A2K6E7J3_BAD-01       atgttccag--a--tcccagagtttgagcctagtg--agcaggaaga---
A0A2K6E7J3_BAD-03       atgttccag--a--tcccagagtttgagcctagtg--agcaggaaga---
A0A2K6ASP2_BBC3-03      ataa---aa------tttggcgtggggtctgcccg------ggcatg---
A0A2K6B5G4_BMF-02       atgg---agcca--tctcggtgtgtggaggagctggaggatgatgtg---
A0A2K6B5G4_BMF-01       atgg---agcca--tctcggtgtgtggaggagctggaggatgatgtg---
A0A2K6B5G4_BMF-04       atgg---agcca--tctcggtgtgtggaggagctggaggatgatgtg---
A0A2K6B5G4_BMF-03       atgg---agcca--tctcggtgtgtggaggagctggaggatgatgtg---

A0A2K6BV75_PMAIP1-      --------------gcgcgcaagaacgcgcaaccgagcccaacgcgg---
A0A2K6BV75_PMAIP1-      --------------gcgcgcaagaacgcgcaaccgagcccaacgcgg---
A0A2K6DBJ4_BIK-01       ggagaccctcctgtatgagcagctcctggaacccctaaccatggaggttc
A0A2K6AYL7_HRK-01       ----ccgcggcc-------gcggccccccggccgtgtgcgcctgcagcgc
A0A2K6E226_BCL2L11      acaattgcagcc-tgcggagaggcctccccagctcagacc--tggggccc
A0A2K6E226_BCL2L11      acaattgcagcc-tgcggagaggcctccccagctcagacc--tggggccc
A0A2K6E226_BCL2L11      acaattgcagcc-tgcggagaggcctccccagctcagacc--tggggccc
A0A2K6E226_BCL2L11      acaattgcagcc-tgcggagaggcctccccagctcagacc--tggggccc
A0A2K6E226_BCL2L11      acaattgcagcc-tgcggagaggcctccccagctcagacc--tggggccc
A0A2K6E226_BCL2L11      acaattgcagcc-tgcggagaggcctccccagctcagacc--tggggccc
A0A2K6E226_BCL2L11      acaattgcagcc-tgcggagaggcctccccagctcagacc--tggggccc
A0A2K6E226_BCL2L11      acaattgcagcc-tgcggagaggcctccccagctcagacc--tggggccc
A0A2K6E226_BCL2L11      acaattgcagcc-tgcggagaggcctccccagctcagacc--tggggccc
A0A2K6E226_BCL2L11      acaattgcagcc-tgcggagaggcctccccagctcagacc--tggggccc
A0A2K6E7J3_BAD-02       ----ctccagctctgcagagaggggcctgggccccagccccgcgggggac
A0A2K6E7J3_BAD-01       ----ctccagctctgcagagaggggcctgggccccagccccgcgggggac
A0A2K6E7J3_BAD-03       ----ctccagctctgcagagaggggcctgggccccagccccgcgggggac
A0A2K6ASP2_BBC3-03      ----tccatgcc--------aggtgcccagggcttcttc---tgcgacgt
A0A2K6B5G4_BMF-02       ----ttccagccggaggacggggagccgggggcccaacc---cggga-gc
A0A2K6B5G4_BMF-01       ----ttccagccggaggacggggagccgggggcccaacc---cggga-gc
A0A2K6B5G4_BMF-04       ----ttccagccggaggacggggagccgggggcccaacc---cggga-gc
A0A2K6B5G4_BMF-03       ----ttccagccggaggacggggagccgggggcccaacc---cggga-gc
                                                        *     *    *      

A0A2K6BV75_PMAIP1-      -----------------------gctcaggcaggac--------------
A0A2K6BV75_PMAIP1-      -----------------------gctcaggcag-----------------
A0A2K6DBJ4_BIK-01       ttggtgtc----------actgaccctgaagag-----------------
A0A2K6AYL7_HRK-01       gggtcgcttggggctgcgctcgtccgccgcgcagctcac-----------
A0A2K6E226_BCL2L11      ctacctcc---------------ctacagacagagccaca----------
A0A2K6E226_BCL2L11      ctacctcc---------------ctacagacagagccacaaggtaatccc
A0A2K6E226_BCL2L11      ctacctcc---------------ctacagacagagccacaaggtaatccc
A0A2K6E226_BCL2L11      ctacctcc---------------ctacagacagagccacaaggtaatccc
A0A2K6E226_BCL2L11      ctacctcc---------------ctacagacagagccacaaggtaatccc
A0A2K6E226_BCL2L11      ctacctcc---------------ctacagacaga----------------
A0A2K6E226_BCL2L11      ctacctcc---------------ctacagacagagccacaaggtaatccc
A0A2K6E226_BCL2L11      ctacctcc---------------ctacagacagagccacaaggtaatccc
A0A2K6E226_BCL2L11      ctacctcc---------------ctacagacagagccacaaggtaatccc
A0A2K6E226_BCL2L11      ctacctcc---------------ctacagacagagccaca----------
A0A2K6E7J3_BAD-02       aggccctc------------agactccggcaagcatcat-----------
A0A2K6E7J3_BAD-01       aggccctc------------agactccggcaagcatcat-----------
A0A2K6E7J3_BAD-03       aggccctc------------agactccggcaagcatcat-----------
A0A2K6ASP2_BBC3-03      gggtcccctgccagatttgtggtcctcagccctcgctct-----------
A0A2K6B5G4_BMF-02       tcgctctctgccgatctgtttgcccagagcctacttgac-----------
A0A2K6B5G4_BMF-01       tcgctctctgccgatctgtttgcccagagcctacttgac-----------
A0A2K6B5G4_BMF-04       tcgctctctgccgatctgtttgcccagagcctacttgac-----------
A0A2K6B5G4_BMF-03       tcgctctctgccgatctgtttgcccagagcctacttgac-----------

A0A2K6BV75_PMAIP1-      ------------------------------cggcagggacggcagggacg
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K6DBJ4_BIK-01       ------------------------------------gacctggaccctat
A0A2K6AYL7_HRK-01       ------------------------------cgcc--------gcccggct
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      gaaggcaatcacggaggtgaaggggacagctgcc--cccacggcagccct
A0A2K6E226_BCL2L11      gaaggcaatcacggaggtgaaggggacagctgcc--cccacggcagccct
A0A2K6E226_BCL2L11      gaaggcaatcacggaggtgaaggggacagctgcc--cccacggcagccct
A0A2K6E226_BCL2L11      gaaggcaatcacggaggtgaaggggacagctgcc--cccacggcagccct
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      gaaggcaatcacggaggtgaaggggacagctgcc--cccacggcagccct
A0A2K6E226_BCL2L11      gaaggcaatcacggaggtgaaggggacagctgcc--cccacggcagccct
A0A2K6E226_BCL2L11      gaaggcaatcacggaggtgaaggggacagctgcc--cccacggcagccct
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E7J3_BAD-02       ------------------------------cgccaggccccaggcctcct
A0A2K6E7J3_BAD-01       ------------------------------cgccaggccccaggcctcct
A0A2K6E7J3_BAD-03       ------------------------------cgccaggccccaggcctcct
A0A2K6ASP2_BBC3-03      ------------------------------tgct--ggcggagcagcacc
A0A2K6B5G4_BMF-02       ------------------------------tgcc--ccctcagccg-act
A0A2K6B5G4_BMF-01       ------------------------------tgcc--ccctcagccg-act
A0A2K6B5G4_BMF-04       ------------------------------tgcc--ccctcagccg-act
A0A2K6B5G4_BMF-03       ------------------------------tgcc--ccctcagccg-act

A0A2K6BV75_PMAIP1-      gcgagggaccaggccggatttgggattgggatgcagctgca---------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K6DBJ4_BIK-01       ggaggacttcgatcctttggagtgtatagaggacagtgacatgttggccc
A0A2K6AYL7_HRK-01       caaggcgcttggcgacgagctg-----------caccagcg----cacca
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      cagggcccgctggccccaccg----------gccagccctg----gccct
A0A2K6E226_BCL2L11      cagggcccgctggccccaccg----------gccagccctg----gccct
A0A2K6E226_BCL2L11      cagggcccgctggccccaccg----------gccagccctg----gccct
A0A2K6E226_BCL2L11      cagggcccgctggccccaccg----------gccagccctg----gccct
A0A2K6E226_BCL2L11      ------------------------------------ccctg----gccct
A0A2K6E226_BCL2L11      cagggcccgctggccccaccg----------gccagccctg----gccct
A0A2K6E226_BCL2L11      cagggcccgctggccccaccg----------gccagccctg----gccct
A0A2K6E226_BCL2L11      cagggcccgctggccccaccg----------gccagccctg----gccct
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E7J3_BAD-02       gtgggacgccagtcaccagcaggagcagccaaccagcagca----gccat
A0A2K6E7J3_BAD-01       gtgggacgccagtcaccagcaggagcagccaaccagcagca----gccat
A0A2K6E7J3_BAD-03       gtgggacgccagtcaccagcaggagcagccaaccagcagca----gccat
A0A2K6ASP2_BBC3-03      tggagtcgcccgtgcccagcg------------ccccgggg----gccct
A0A2K6B5G4_BMF-02       tcagctcttccctctcaccca------------ctgctgtg----gccct
A0A2K6B5G4_BMF-01       tcagctcttccctctcaccca------------ctgctgtg----gccct
A0A2K6B5G4_BMF-04       tcagctcttccctctcaccca------------ctgctgtg----gccct
A0A2K6B5G4_BMF-03       tcagctcttccctctcaccca------------ctgctgtg----gccct

A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K6DBJ4_BIK-01       tgcgg---------------------------------------------
A0A2K6AYL7_HRK-01       tgtgg---------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      tttgc---------------------------------------------
A0A2K6E226_BCL2L11      tttgc---------------------------------------------
A0A2K6E226_BCL2L11      tttgc---------------------------------------------
A0A2K6E226_BCL2L11      tttgc---------------------------------------------
A0A2K6E226_BCL2L11      tttgc---------------------------------------------
A0A2K6E226_BCL2L11      tttgc---------------------------------------------
A0A2K6E226_BCL2L11      tttgc---------------------------------------------
A0A2K6E226_BCL2L11      tttgc---------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E7J3_BAD-02       catggagggacttcct----------------------------------
A0A2K6E7J3_BAD-01       catgg---------------------------------------------
A0A2K6E7J3_BAD-03       catggagggagagcttggtattctccttcttgggaatctgaggactctga
A0A2K6ASP2_BBC3-03      ggcgg---------------------------------------------
A0A2K6B5G4_BMF-02       ggcct---------------------------------------------
A0A2K6B5G4_BMF-01       ggcct---------------------------------------------
A0A2K6B5G4_BMF-04       ggcct---------------------------------------------
A0A2K6B5G4_BMF-03       ggcct---------------------------------------------

A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      -taccagatccccgcttttcatctttatgagaagatcctccctgctgtct
A0A2K6E226_BCL2L11      -taccagatccccgcttttcatctttatgagaagatcctccctgctgtct
A0A2K6E226_BCL2L11      -taccagatccccgcttttcatctttatgagaagatcctccctgctgtct
A0A2K6E226_BCL2L11      -taccagatccccgcttttcatctttatgagaagatcctccctgctgtct
A0A2K6E226_BCL2L11      -taccagatcccc-------------------------------------
A0A2K6E226_BCL2L11      -taccagatccccgcttttcatctttatgagaagatcctccctgctgtct
A0A2K6E226_BCL2L11      -taccagatccccgcttttcatctttatgagaagatcctccctgctgtct
A0A2K6E226_BCL2L11      -taccagatccccgcttttcatctttatgagaagatcctccctgctgtct
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E7J3_BAD-02       --------------------------------------------------
A0A2K6E7J3_BAD-01       --------------------------------------------------
A0A2K6E7J3_BAD-03       aaatcccagtgcaaggatgctcgcggaagcatcagcacggatgtctgccc
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2K6B5G4_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-04       --------------------------------------------------
A0A2K6B5G4_BMF-03       --------------------------------------------------

A0A2K6BV75_PMAIP1-      -----------------------------------------------tta
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------ctggcc
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------agacaggagcccagcacc
A0A2K6E226_BCL2L11      cgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
A0A2K6E226_BCL2L11      cgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
A0A2K6E226_BCL2L11      cgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
A0A2K6E226_BCL2L11      cgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      cgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
A0A2K6E226_BCL2L11      cgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
A0A2K6E226_BCL2L11      cgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
A0A2K6E226_BCL2L11      --------------------------------agacaggagcccagcacc
A0A2K6E7J3_BAD-02       -----------------------cgcccgaagagcgcgggcacagcgacg
A0A2K6E7J3_BAD-01       ---------------------------------------------aggcg
A0A2K6E7J3_BAD-03       cagccactgactcagaagcccaacacgcagagaatgtaaagctgaaggcg
A0A2K6ASP2_BBC3-03      --------------------------------------------gcggtc
A0A2K6B5G4_BMF-02       --------------------------------------------tcgacc
A0A2K6B5G4_BMF-01       --------------------------------------------tcgacc
A0A2K6B5G4_BMF-04       --------------------------------------------tcgacc
A0A2K6B5G4_BMF-03       --------------------------------------------tcgacc

A0A2K6BV75_PMAIP1-      caccagaggcaaaaagctcgtctcctcctccccacttgtccttccgcggg
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K6DBJ4_BIK-01       tgcatcggggacgagatggatgtgagcctcagggccccgcgcctggccca
A0A2K6AYL7_HRK-01       -------------------------------------cggcgccg-----
A0A2K6E226_BCL2L11      catgagttgtgacaaatcaacacaaaccccaagtcctccttgcca-----
A0A2K6E226_BCL2L11      catgagttgtgacaaatcaacacaaaccccaagtcctccttgcca-----
A0A2K6E226_BCL2L11      catgagttgtgacaaatcaacacaaaccccaagtcctccttgcca-----
A0A2K6E226_BCL2L11      catgagttgtgacaaatcaacacaaaccccaagtcctccttgcca-----
A0A2K6E226_BCL2L11      catgagttgtgacaaatcaacacaaaccccaagtcctccttgcca-----
A0A2K6E226_BCL2L11      ------ttgtgacaaatcaacacaaaccccaagtcctccttgcca-----
A0A2K6E226_BCL2L11      catgagttgtgacaaatcaacacaaaccccaagtcctccttgcca-----
A0A2K6E226_BCL2L11      catgagttgtgacaaatcaacacaaaccccaagtcctccttgcca-----
A0A2K6E226_BCL2L11      catgagttgtgacaaatcaacacaaaccccaagtcctccttgcca-----
A0A2K6E226_BCL2L11      catgagttgtgacaaatcaacacaaaccccaagtcctccttgcca-----
A0A2K6E7J3_BAD-02       cagatgcggcaa-agctccagctggacgcgagtcttccagtcctgg----
A0A2K6E7J3_BAD-01       ctggggctgtgg-agacccg--cagtcgccacagctcctaccccgc----
A0A2K6E7J3_BAD-03       ctggggctgtgg-agacccg--cagtcgccacagctcctaccccgc----
A0A2K6ASP2_BBC3-03      ---------------------cca---cccagg----cggccccg-----
A0A2K6B5G4_BMF-02       caccagccagga-agacaaggcca---cccagaccctcggcccagcctcc
A0A2K6B5G4_BMF-01       caccagccagga-agacaaggcca---cccagaccctcggcccagcctcc
A0A2K6B5G4_BMF-04       caccagccagga-agacaaggcca---cccagaccctcggcccagcctcc
A0A2K6B5G4_BMF-03       caccagccagga-agacaaggcca---cccagaccctcggcccagcctcc

A0A2K6BV75_PMAIP1-      gccacgaggaacaagtgcaagtagctcgaagtcgagtgtgctactca---
A0A2K6BV75_PMAIP1-      ----------------------agctcgaagtcgagtgtgctactca---
A0A2K6DBJ4_BIK-01       gctctctgaggtggccatgcacagcctgggtct------ggctttcatct
A0A2K6AYL7_HRK-01       ------------------------cgcgcggagccggagggcgc-cggc-
A0A2K6E226_BCL2L11      ---------------------------------------ggccttcaacc
A0A2K6E226_BCL2L11      ---------------------------------------ggccttcaacc
A0A2K6E226_BCL2L11      ---------------------------------------ggccttcaacc
A0A2K6E226_BCL2L11      ---------------------------------------ggccttcaacc
A0A2K6E226_BCL2L11      ---------------------------------------ggccttcaacc
A0A2K6E226_BCL2L11      ---------------------------------------ggccttcaacc
A0A2K6E226_BCL2L11      ---------------------------------------ggccttcaacc
A0A2K6E226_BCL2L11      ---------------------------------------ggccttcaacc
A0A2K6E226_BCL2L11      ---------------------------------------ggccttcaacc
A0A2K6E226_BCL2L11      ---------------------------------------ggccttcaacc
A0A2K6E7J3_BAD-02       ---------tgggatcg--------gaacttgggcaggggaagctccgca
A0A2K6E7J3_BAD-01       ---------ggggacggaggaggacgaagggatggaggaggagcccagc-
A0A2K6E7J3_BAD-03       ---------ggggacggaggaggacgaagggatggaggaggagcccagc-
A0A2K6ASP2_BBC3-03      ---------ggagtc---------cgcggggag---gaggaa---cagtg
A0A2K6B5G4_BMF-02       cccagccaaggtgtcatgctgccttgtggggtaactgaggaaccccagcg
A0A2K6B5G4_BMF-01       cccagccaaggtgtcatgctgccttgtggggtaactgaggaaccccagcg
A0A2K6B5G4_BMF-04       cccagccaaggtgtcatgctgccttgtggggtaactgaggaaccccagcg
A0A2K6B5G4_BMF-03       cccagccaaggtgtcatgctgccttgtggggtaactgaggaaccccagcg
                                                               *     *    

A0A2K6BV75_PMAIP1-      -----------------------------------------------act
A0A2K6BV75_PMAIP1-      -----------------------------------------------act
A0A2K6DBJ4_BIK-01       acgaccagatggacgacatcagggatgt-------------------tct
A0A2K6AYL7_HRK-01       -----------------------------------------------gcc
A0A2K6E226_BCL2L11      acta-------------------------------------------tct
A0A2K6E226_BCL2L11      acta-------------------------------------------tct
A0A2K6E226_BCL2L11      acta-------------------------------------------tct
A0A2K6E226_BCL2L11      acta-------------------------------------------tct
A0A2K6E226_BCL2L11      acta-------------------------------------------tct
A0A2K6E226_BCL2L11      acta-------------------------------------------tct
A0A2K6E226_BCL2L11      acta-------------------------------------------tct
A0A2K6E226_BCL2L11      acta-------------------------------------------tct
A0A2K6E226_BCL2L11      acta-------------------------------------------tct
A0A2K6E226_BCL2L11      acta-------------------------------------------tct
A0A2K6E7J3_BAD-02       ccc--------------------------------------------tcc
A0A2K6E7J3_BAD-01       ccc--------------------------------------------ttt
A0A2K6E7J3_BAD-03       ccc--------------------------------------------ttt
A0A2K6ASP2_BBC3-03      g----------------------------------------------gcc
A0A2K6B5G4_BMF-02       actcttttacggcaatgctggctaccggcttcctctccctgccagtttcc
A0A2K6B5G4_BMF-01       actcttttacggcaatgctggctaccggcttcctctccctgccagtttcc
A0A2K6B5G4_BMF-04       actcttttacggcaatgctggctaccggcttcctctccctgccagtttcc
A0A2K6B5G4_BMF-03       actcttttacg---------------------------------------

A0A2K6BV75_PMAIP1-      caggagatttggagac----------------------------------
A0A2K6BV75_PMAIP1-      caggagatttggagac----------------------------------
A0A2K6DBJ4_BIK-01       tagaagtttcatggatggtttcac--------------------------
A0A2K6AYL7_HRK-01       cggcgcgctccccacctactggcc--------------------------
A0A2K6E226_BCL2L11      cagtg-------caatggtagtca--------------------------
A0A2K6E226_BCL2L11      cagtg-------caatggtt------------------------------
A0A2K6E226_BCL2L11      cagtg-------caatggct------------------------------
A0A2K6E226_BCL2L11      cagtg-------caatggcttccaggaggcaggctgaacctgcagatatg
A0A2K6E226_BCL2L11      cagtg-------caatggcttccaggaggcaggctgaacctgcagatatg
A0A2K6E226_BCL2L11      cagtg-------caatggcttccaggaggcaggctgaacctgcagatatg
A0A2K6E226_BCL2L11      cagtg-------caat----------------------------------
A0A2K6E226_BCL2L11      cagtg-------caatggcttccaggaggcaggctgaacctgcagatatg
A0A2K6E226_BCL2L11      cagtg-------caatggcttccaggaggcaggctgaacctgcagatatg
A0A2K6E226_BCL2L11      cagtg-------caatggcttccaggaggcaggctgaacctgcagatatg
A0A2K6E7J3_BAD-02       cagtgacctt--cgctccacgccc--------------------------
A0A2K6E7J3_BAD-01       cggggccgctcgcgctccgcgccc--------------------------
A0A2K6E7J3_BAD-03       cggggccgctcgcgctccgcgccc--------------------------
A0A2K6ASP2_BBC3-03      cgggag--------atcggggccc--------------------------
A0A2K6B5G4_BMF-02       cggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacat
A0A2K6B5G4_BMF-01       cggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacat
A0A2K6B5G4_BMF-04       cggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacat
A0A2K6B5G4_BMF-03       --------------------------------------------------

A0A2K6BV75_PMAIP1-      ------aaactaaacttccggcagaaacttctgaatctgatagccaaact
A0A2K6BV75_PMAIP1-      ------aaactaaacttccggcagaaacttctgaatctgatagccaaact
A0A2K6DBJ4_BIK-01       cacccttagggagaacataatgaggttctggagatccccgaatcccaggt
A0A2K6AYL7_HRK-01       --------------------------ctggctgtgcgcggccgcgcaggt
A0A2K6E226_BCL2L11      tcctagaggatatag-----------gtgatagttcattgtggtttggat
A0A2K6E226_BCL2L11      -----------------------------------------agagaaat-
A0A2K6E226_BCL2L11      ------------------------------------aactgggactag--
A0A2K6E226_BCL2L11      cgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtt
A0A2K6E226_BCL2L11      cgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtt
A0A2K6E226_BCL2L11      cgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtt
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      cgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtt
A0A2K6E226_BCL2L11      cgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtt
A0A2K6E226_BCL2L11      cgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtt
A0A2K6E7J3_BAD-02       --------------------------------ggaaactccacccgctct
A0A2K6E7J3_BAD-01       ------------------------------------------cccaacct
A0A2K6E7J3_BAD-03       ------------------------------------------cccaacct
A0A2K6ASP2_BBC3-03      -------------------------agctgcggcggatggcggacgacct
A0A2K6B5G4_BMF-02       cgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagtt
A0A2K6B5G4_BMF-01       cgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagtt
A0A2K6B5G4_BMF-04       cgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagtt
A0A2K6B5G4_BMF-03       --------------------------------------------------

A0A2K6BV75_PMAIP1-      cttctgctca-----------------------ggaacctgactgcatca
A0A2K6BV75_PMAIP1-      cttctgctca-----------------------ggaacctga--------
A0A2K6DBJ4_BIK-01       cctgggtgtcccgtgaacaggtgctgctggtgctgctgctg-ctgctggc
A0A2K6AYL7_HRK-01       ---------------------------------ggcggcg--ctggcggc
A0A2K6E226_BCL2L11      tt-atatttactggcttagatttgtatggccaccaccacagtcaagatac
A0A2K6E226_BCL2L11      ------------------agaggaagttgtcg-tgtag------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      ta-acgcttactatgcaaggaggatgtcgct-------------------
A0A2K6E226_BCL2L11      ta-acgcttactatgcaaggaggtta-----g-agaaatag---------
A0A2K6E226_BCL2L11      ta-acgcttactatgcaaggagggtatttttg-aataattaccaagcagc
A0A2K6E226_BCL2L11      ---------------------gggtatttttg-aataa------------
A0A2K6E226_BCL2L11      ta-acgcttactatgcaaggagggtatttttg-aataattaccaagcagc
A0A2K6E226_BCL2L11      ta-acgcttactatgcaaggagggtatttttg-aataattaccaagcagc
A0A2K6E226_BCL2L11      ta-acgcttactatgcaaggagggtatttttg-aataattaccaagcagc
A0A2K6E7J3_BAD-02       ca-ctgtcctcgtcggccatcttggatatg---ggcggaagtgcttccct
A0A2K6E7J3_BAD-01       c---------------------------tg---ggcagcacagcgt---t
A0A2K6E7J3_BAD-03       c---------------------------tg---ggcagcacagcgt---t
A0A2K6ASP2_BBC3-03      ca-acgcgcaatacgagcggcggagacaag---aggagca--gcagcgac
A0A2K6B5G4_BMF-02       cc-accggctccatgtgcag------caac---accagca--gaaccgaa
A0A2K6B5G4_BMF-01       cc-accggctccatgtgcag------caac---accagca--gaaccgaa
A0A2K6B5G4_BMF-04       cc-accggctccatgtgcag------caac---accagca--gaaccgaa
A0A2K6B5G4_BMF-03       -----------------------------c---accagca--gaaccgaa

A0A2K6BV75_PMAIP1-      aaaact--------tgcataaggggactccaaaagagactttttctcagg
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K6DBJ4_BIK-01       actgctgctggcgctgctcagcgggggcctgcacctgctgctcaagtga-
A0A2K6AYL7_HRK-01       ctggctgct-----cg-gcaggcggaacttgtag----------------
A0A2K6E226_BCL2L11      agaacaact-----caaccacaaggatttctcatga--------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      cgaagacca-----cccacaaatggttatcttacgactgttgcg-----t
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      cgaagacca-----cccacaaatggttatcttacgactgttgcg-----t
A0A2K6E226_BCL2L11      cgaagacca-----cccacaaatggttatcttacgactgttgcg-----t
A0A2K6E226_BCL2L11      cgaagacca-----cccacaaatggttatcttacgactgttgcg-----t
A0A2K6E7J3_BAD-02       caggcctta-----tgcaaaagaggatccgtgctgcctctttcg------
A0A2K6E7J3_BAD-01       atggccgcg-----agctccggaggatgagtgacgagtttgtggactcct
A0A2K6E7J3_BAD-03       atggccgcg-----agctccggaggatga---------------------
A0A2K6ASP2_BBC3-03      accgcccct-----cgccctggagggtcctgtacaatctcatca-----t
A0A2K6B5G4_BMF-02       atcgcgtgt-----gg---tggcagatcct------cctcttcc-----t
A0A2K6B5G4_BMF-01       atcgcgtgt-----gg---tggcagatcct------cctcttcc-----t
A0A2K6B5G4_BMF-04       atcgcgtgt-----gg---tggcagatcct------cctcttcc-----t
A0A2K6B5G4_BMF-03       atcgcgtgt-----gg---tggcagatcct------cctcttcc-----t

A0A2K6BV75_PMAIP1-      aggtgcacacttcatcaatttgaagaaagattgcattgtaattgg-----
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      -------tccacctg-------------attaa-----------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      tacattgtccgcctggtgtggagaatgcattga-----------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      tacattgtccgcctggtgtggagaatgcattga-----------------
A0A2K6E226_BCL2L11      tacattgtccgcctggtgtggagaatgcattga-----------------
A0A2K6E226_BCL2L11      tacattgtccgcctggtgtggagaatgcattga-----------------
A0A2K6E7J3_BAD-02       --------------------------gtgggagggctgacccagattc--
A0A2K6E7J3_BAD-01       ttaagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcgg
A0A2K6E7J3_BAD-03       --------------------------------------------------
A0A2K6ASP2_BBC3-03      gggactcctgcccttacccaggggccacagagcccccgaaatggagcc--
A0A2K6B5G4_BMF-02       gcacaaccttgctttgaatggagaagagaacaggaacggggcgggccc--
A0A2K6B5G4_BMF-01       gcacaaccttgctttgaatggagaagagaacaggaacggggcgggccc--
A0A2K6B5G4_BMF-04       gcacaaccttgctttgaatggagaagagaacaggaacggggcgggccc--
A0A2K6B5G4_BMF-03       gcacaaccttgctttgaatggagaagagaacaggaacggggcgggccc--

A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E7J3_BAD-02       ----------------------ccttccggtgcatgtga-----------
A0A2K6E7J3_BAD-01       caaagctccagctggacgcgagtcttccagtcctggtgggatcggaactt
A0A2K6E7J3_BAD-03       --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------caattag-----------
A0A2K6B5G4_BMF-02       --------------------------------taggtga-----------
A0A2K6B5G4_BMF-01       --------------------------------taggtga-----------
A0A2K6B5G4_BMF-04       --------------------------------taggtga-----------
A0A2K6B5G4_BMF-03       --------------------------------tag---------------

A0A2K6BV75_PMAIP1-      -------------------------------
A0A2K6BV75_PMAIP1-      -------------------------------
A0A2K6DBJ4_BIK-01       -------------------------------
A0A2K6AYL7_HRK-01       -------------------------------
A0A2K6E226_BCL2L11      -------------------------------
A0A2K6E226_BCL2L11      -------------------------------
A0A2K6E226_BCL2L11      -------------------------------
A0A2K6E226_BCL2L11      -------------------------------
A0A2K6E226_BCL2L11      -------------------------------
A0A2K6E226_BCL2L11      -------------------------------
A0A2K6E226_BCL2L11      -------------------------------
A0A2K6E226_BCL2L11      -------------------------------
A0A2K6E226_BCL2L11      -------------------------------
A0A2K6E226_BCL2L11      -------------------------------
A0A2K6E7J3_BAD-02       -------------------------------
A0A2K6E7J3_BAD-01       gggcaggggaagctccgcaccctcccagtga
A0A2K6E7J3_BAD-03       -------------------------------
A0A2K6ASP2_BBC3-03      -------------------------------
A0A2K6B5G4_BMF-02       -------------------------------
A0A2K6B5G4_BMF-01       -------------------------------
A0A2K6B5G4_BMF-04       -------------------------------
A0A2K6B5G4_BMF-03       -------------------------------

© 1998-2019