Dataset for CDS BMF of organism Macaca nemestrina

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6B5G4_BMF-01      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc
A0A2K6B5G4_BMF-04      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc
A0A2K6B5G4_BMF-02      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc
A0A2K6B5G4_BMF-03      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagcc
                       **************************************************

A0A2K6B5G4_BMF-01      ggaggacggggagccgggggcccaacccgggagctcgctctctgccgatc
A0A2K6B5G4_BMF-04      ggaggacggggagccgggggcccaacccgggagctcgctctctgccgatc
A0A2K6B5G4_BMF-02      ggaggacggggagccgggggcccaacccgggagctcgctctctgccgatc
A0A2K6B5G4_BMF-03      ggaggacggggagccgggggcccaacccgggagctcgctctctgccgatc
                       **************************************************

A0A2K6B5G4_BMF-01      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
A0A2K6B5G4_BMF-04      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
A0A2K6B5G4_BMF-02      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
A0A2K6B5G4_BMF-03      tgtttgcccagagcctacttgactgccccctcagccgacttcagctcttc
                       **************************************************

A0A2K6B5G4_BMF-01      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A2K6B5G4_BMF-04      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A2K6B5G4_BMF-02      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A2K6B5G4_BMF-03      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
                       **************************************************

A0A2K6B5G4_BMF-01      caaggccacccagaccctcggcccagcctcccccagccaaggtgtcatgc
A0A2K6B5G4_BMF-04      caaggccacccagaccctcggcccagcctcccccagccaaggtgtcatgc
A0A2K6B5G4_BMF-02      caaggccacccagaccctcggcccagcctcccccagccaaggtgtcatgc
A0A2K6B5G4_BMF-03      caaggccacccagaccctcggcccagcctcccccagccaaggtgtcatgc
                       **************************************************

A0A2K6B5G4_BMF-01      tgccttgtggggtaactgaggaaccccagcgactcttttacggcaatgct
A0A2K6B5G4_BMF-04      tgccttgtggggtaactgaggaaccccagcgactcttttacggcaatgct
A0A2K6B5G4_BMF-02      tgccttgtggggtaactgaggaaccccagcgactcttttacggcaatgct
A0A2K6B5G4_BMF-03      tgccttgtggggtaactgaggaaccccagcgactcttttacg--------
                       ******************************************        

A0A2K6B5G4_BMF-01      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg
A0A2K6B5G4_BMF-04      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg
A0A2K6B5G4_BMF-02      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg
A0A2K6B5G4_BMF-03      --------------------------------------------------
                                                                         

A0A2K6B5G4_BMF-01      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
A0A2K6B5G4_BMF-04      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
A0A2K6B5G4_BMF-02      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
A0A2K6B5G4_BMF-03      --------------------------------------------------
                                                                         

A0A2K6B5G4_BMF-01      cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcag
A0A2K6B5G4_BMF-04      cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcag
A0A2K6B5G4_BMF-02      cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcag
A0A2K6B5G4_BMF-03      --------------------------------------------------
                                                                         

A0A2K6B5G4_BMF-01      caacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
A0A2K6B5G4_BMF-04      caacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
A0A2K6B5G4_BMF-02      caacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
A0A2K6B5G4_BMF-03      ---caccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
                          ***********************************************

A0A2K6B5G4_BMF-01      gcacaaccttgctttgaatggagaagagaacaggaacggggcgggcccta
A0A2K6B5G4_BMF-04      gcacaaccttgctttgaatggagaagagaacaggaacggggcgggcccta
A0A2K6B5G4_BMF-02      gcacaaccttgctttgaatggagaagagaacaggaacggggcgggcccta
A0A2K6B5G4_BMF-03      gcacaaccttgctttgaatggagaagagaacaggaacggggcgggcccta
                       **************************************************

A0A2K6B5G4_BMF-01      ggtga
A0A2K6B5G4_BMF-04      ggtga
A0A2K6B5G4_BMF-02      ggtga
A0A2K6B5G4_BMF-03      g----
                       *    

© 1998-2018