Dataset for CDS BAD of organism Macaca nemestrina

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6E7J3_BAD-02      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
A0A2K6E7J3_BAD-03      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
A0A2K6E7J3_BAD-01      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc

A0A2K6E7J3_BAD-02      tgcagagaggggcctgggccccagccccgcgggggacaggccctcagact
A0A2K6E7J3_BAD-03      tgcagagaggggcctgggccccagccccgcgggggacaggccctcagact
A0A2K6E7J3_BAD-01      tgcagagaggggcctgggccccagccccgcgggggacaggccctcagact

A0A2K6E7J3_BAD-02      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2K6E7J3_BAD-03      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2K6E7J3_BAD-01      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac

A0A2K6E7J3_BAD-02      cagcaggagcagccaaccagcagcagccatcatggagggacttcct----
A0A2K6E7J3_BAD-03      cagcaggagcagccaaccagcagcagccatcatggagggagagcttggta
A0A2K6E7J3_BAD-01      cagcaggagcagccaaccagcagcagccatcatgg---------------

A0A2K6E7J3_BAD-02      --------------------------------------------------
A0A2K6E7J3_BAD-03      ttctccttcttgggaatctgaggactctgaaaatcccagtgcaaggatgc
A0A2K6E7J3_BAD-01      --------------------------------------------------

A0A2K6E7J3_BAD-02      --------------------------------------------------
A0A2K6E7J3_BAD-03      tcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcc
A0A2K6E7J3_BAD-01      --------------------------------------------------

A0A2K6E7J3_BAD-02      ---cgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctccag
A0A2K6E7J3_BAD-03      caacacgcagagaatgtaaagctgaaggcgctggggctgtggagacccg-
A0A2K6E7J3_BAD-01      -------------------------aggcgctggggctgtggagacccg-
                                                 * *** *  ** *   **  **  

A0A2K6E7J3_BAD-02      ctggacgcgagtcttccagtcctggtgggatcg--------gaacttggg
A0A2K6E7J3_BAD-03      -cagtcgccacagctcctaccccgcggggacggaggaggacgaagggatg
A0A2K6E7J3_BAD-01      -cagtcgccacagctcctaccccgcggggacggaggaggacgaagggatg
                          * *** *    ***   ** *  ****  *        ***     *

A0A2K6E7J3_BAD-02      caggggaagctccgcaccctcccagtgacctt--cgctccacgcccggaa
A0A2K6E7J3_BAD-03      gaggaggagcccagc-ccctttcggggccgctcgcgctccgcgccc----
A0A2K6E7J3_BAD-01      gaggaggagcccagc-ccctttcggggccgctcgcgctccgcgccc----
                        *** * *** * ** ****  * * * *  *  ****** *****    

A0A2K6E7J3_BAD-02      actccacccgctctcactgtcctcgtcggccatcttggatatgggcggaa
A0A2K6E7J3_BAD-03      ------cccaacctc--------------------------tgggcagca
A0A2K6E7J3_BAD-01      ------cccaacctc--------------------------tgggcagca
                             ***   ***                          ***** * *

A0A2K6E7J3_BAD-02      gtgcttccctcaggccttatgcaaaagaggatccgtgctgcctctttcg-
A0A2K6E7J3_BAD-03      cagcgt---tatggccgcgagctccggaggatga----------------
A0A2K6E7J3_BAD-01      cagcgt---tatggccgcgagctccggaggatgagtgacgagtttgtgga
                         ** *   *  ****    **    ******                  

A0A2K6E7J3_BAD-02      -------------------------------gtgggagggctgacccaga
A0A2K6E7J3_BAD-03      --------------------------------------------------
A0A2K6E7J3_BAD-01      ctcctttaagggacttcctcgcccgaagagcgcgggcacagcgacgcaga

A0A2K6E7J3_BAD-02      ttc------------------------ccttccggtgcatgtga------
A0A2K6E7J3_BAD-03      --------------------------------------------------
A0A2K6E7J3_BAD-01      tgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcgg

A0A2K6E7J3_BAD-02      ------------------------------------
A0A2K6E7J3_BAD-03      ------------------------------------
A0A2K6E7J3_BAD-01      aacttgggcaggggaagctccgcaccctcccagtga

© 1998-2019