Dataset for CDS classical BH3-containing proteins of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

17 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1D5QGJ8_PMAIP1-      atg-----------------------------------------------
A0A1D5R1E4_HRK-01       atgtgcccg---------------tgccccctgcaccgcggccgcggccc
F7HHA9_BCL2L11-08       atggcaaagcaaccttctgatgtaagttctgagtgtga----ccgagaag
F7HHA9_BCL2L11-09       atggcaaagcaaccttctgatgtaagttctgagtgtga----ccgagaag
F7HHA9_BCL2L11-07       atggcaaagcaaccttctgatgtaagttctgagtgtga----ccgagaag
F7HHA9_BCL2L11-05       atggcaaagcaaccttctgatgtaagttctgagtgtga----ccgagaag
F7HHA9_BCL2L11-03       atggcaaagcaaccttctgatgtaagttctgagtgtga----ccgagaag
F7HHA9_BCL2L11-02       atggcaaagcaaccttctgatgtaagttctgagtgtga----ccgagaag
F7HHA9_BCL2L11-04       atggcaaagcaaccttctgatgtaagttctgagtgtga----ccgagaag
F7HHA9_BCL2L11-06       atggcaaagcaaccttctgatgtaagttctgagtgtga----ccgagaag
F7HHA9_BCL2L11-01       atggcaaagcaaccttctgatgtaagttctgagtgtga----ccgagaag
F7GVS7_BAD-04           --------------------------------------------------
F7GVS7_BAD-02           atgttccag---------------atcccagagtttga---gcctagtga
F7GVS7_BAD-01           atgttccag---------------atcccagagtttga---gcctagtga
F7GVS7_BAD-03           atgttccag---------------atcccagagtttga---gcctagtga
F7CM09_BMF-02           atggagcc----------------atctcggtgtgtggaggagctggagg
F7FFP6_BBC3-03          ataaaa--------------------tttggcgtgggg------------

A0A1D5QGJ8_PMAIP1-      --------------cctgggaagaaggcgcgcaagaacgcgcaaccgagc
A0A1D5R1E4_HRK-01       cccggccgtgtgcgcctgcagcgcgggtcgcttggggctgcgctcgtccg
F7HHA9_BCL2L11-08       gtagacaattgcagcctgcggagaggcctccccag---------------
F7HHA9_BCL2L11-09       gtagacaattgcagcctgcggagaggcctccccag---------------
F7HHA9_BCL2L11-07       gtagacaattgcagcctgcggagaggcctccccag---------------
F7HHA9_BCL2L11-05       gtagacaattgcagcctgcggagaggcctccccag---------------
F7HHA9_BCL2L11-03       gtagacaattgcagcctgcggagaggcctccccag---------------
F7HHA9_BCL2L11-02       gtagacaattgcagcctgcggagaggcctccccag---------------
F7HHA9_BCL2L11-04       gtagacaattgcagcctgcggagaggcctccccag---------------
F7HHA9_BCL2L11-06       gtagacaattgcagcctgcggagaggcctccccag---------------
F7HHA9_BCL2L11-01       gtagacaattgcagcctgcggagaggcctccccag---------------
F7GVS7_BAD-04           --------------------------------------------------
F7GVS7_BAD-02           gcaggaagactccagctctgcagagaggggcctgggccccagccccgcgg
F7GVS7_BAD-01           gcaggaagactccagctctgcagagaggggcctgggccccagccccgcgg
F7GVS7_BAD-03           gcaggaagactccagctctgcagagaggggcctgggccccagccccgcgg
F7CM09_BMF-02           atgatgtgttccagccggaggacgggga-gccgggggcccaaccc----g
F7FFP6_BBC3-03          ----------tctgcccgggcatgtccatgccaggtgccca---------

A0A1D5QGJ8_PMAIP1-      ccaacgcgggctcaggca--------------------------------
A0A1D5R1E4_HRK-01       ccgcgcagctcaccgccg--------------------------------
F7HHA9_BCL2L11-08       ----------ctcagacc--------------------------------
F7HHA9_BCL2L11-09       ----------ctcagacc--------------------------------
F7HHA9_BCL2L11-07       ----------ctcagacc--------------------------------
F7HHA9_BCL2L11-05       ----------ctcagacc--------------------------------
F7HHA9_BCL2L11-03       ----------ctcagacc--------------------------------
F7HHA9_BCL2L11-02       ----------ctcagacc--------------------------------
F7HHA9_BCL2L11-04       ----------ctcagacc--------------------------------
F7HHA9_BCL2L11-06       ----------ctcagacc--------------------------------
F7HHA9_BCL2L11-01       ----------ctcagacc--------------------------------
F7GVS7_BAD-04           --------------------------------------------------
F7GVS7_BAD-02           gggacaggccctcagact--------------------------------
F7GVS7_BAD-01           gggacaggccctcagact--------------------------------
F7GVS7_BAD-03           gggacaggccctcagact--------------------------------
F7CM09_BMF-02           ggagctcgctctctgccgatctgtttgcccagagcctacttgactgcccc
F7FFP6_BBC3-03          -gggcttcttctgcgacg--------------------------tgggtc

A0A1D5QGJ8_PMAIP1-      ------------------------------------------gcggggac
A0A1D5R1E4_HRK-01       -----------------------cccggctcaaggcgcttggcgacgagc
F7HHA9_BCL2L11-08       --------------------------------------------tggggc
F7HHA9_BCL2L11-09       --------------------------------------------tggggc
F7HHA9_BCL2L11-07       --------------------------------------------tggggc
F7HHA9_BCL2L11-05       --------------------------------------------tggggc
F7HHA9_BCL2L11-03       --------------------------------------------tggggc
F7HHA9_BCL2L11-02       --------------------------------------------tggggc
F7HHA9_BCL2L11-04       --------------------------------------------tggggc
F7HHA9_BCL2L11-06       --------------------------------------------tggggc
F7HHA9_BCL2L11-01       --------------------------------------------tggggc
F7GVS7_BAD-04           --------------------------------------------------
F7GVS7_BAD-02           -ccggcaag---------------------------catcatcgccaggc
F7GVS7_BAD-01           -ccggcaag---------------------------catcatcgccaggc
F7GVS7_BAD-03           -ccggcaag---------------------------catcatcgccaggc
F7CM09_BMF-02           ctcagccgacttcagctcttccctctcacccactgctgtggccct-ggcc
F7FFP6_BBC3-03          ccctgccagatt------------------------tgtggtcctcagcc

A0A1D5QGJ8_PMAIP1-      tgcagggacggcagggacggcgagggaccaggccggatttgggattgg--
A0A1D5R1E4_HRK-01       tgcaccagcgcaccatgtggcggcgccgcgcgcggagccggagggcgccg
F7HHA9_BCL2L11-08       ccctacctcccta---------------cagacagagccacaa-------
F7HHA9_BCL2L11-09       ccctacctcccta---------------cagacagagccacaa-------
F7HHA9_BCL2L11-07       ccctacctcccta---------------cagacagagccacaa-------
F7HHA9_BCL2L11-05       ccctacctcccta---------------cagacagagccacaagct----
F7HHA9_BCL2L11-03       ccctacctcccta---------------cagacagagccacaaggtaa--
F7HHA9_BCL2L11-02       ccctacctcccta---------------cagacagagccacaaggtaa--
F7HHA9_BCL2L11-04       ccctacctcccta---------------cagacagagccacaaggtaa--
F7HHA9_BCL2L11-06       ccctacctcccta---------------cagacagagccacaaggtaa--
F7HHA9_BCL2L11-01       ccctacctcccta---------------cagacagagccacaaggtaa--
F7GVS7_BAD-04           --------------------------------------------------
F7GVS7_BAD-02           cccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagca
F7GVS7_BAD-01           cccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagca
F7GVS7_BAD-03           cccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagca
F7CM09_BMF-02           ttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcc
F7FFP6_BBC3-03          ctcgctcttgctggcggag-------------cagcacctggagtcgccc

A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A1D5R1E4_HRK-01       gcgtccggc-----------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
F7GVS7_BAD-04           --------------------------------------------------
F7GVS7_BAD-02           gcagccatcatggagggacttcct--------------------------
F7GVS7_BAD-01           gcagccatcatgg-------------------------------------
F7GVS7_BAD-03           gcagccatcatggagggagagcttggtattctccttcttgggaatctgag
F7CM09_BMF-02           tcccccagccaaggtgtcatgctg--------------------------
F7FFP6_BBC3-03          gtgcccagc--------------g--------------------------

A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
F7GVS7_BAD-04           --------------------------------------------------
F7GVS7_BAD-02           --------------------------------------------------
F7GVS7_BAD-01           --------------------------------------------------
F7GVS7_BAD-03           gactctgaaaatcccagtgcaaggatgctcgcggaagcatcagcacggat
F7CM09_BMF-02           --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------

A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------tccaggaggca-------
F7HHA9_BCL2L11-03       --------------------------------tcccgaaggcaatcacgg
F7HHA9_BCL2L11-02       --------------------------------tcccgaaggcaatcacgg
F7HHA9_BCL2L11-04       --------------------------------tcccgaaggcaatcacgg
F7HHA9_BCL2L11-06       --------------------------------tcccgaaggcaatcacgg
F7HHA9_BCL2L11-01       --------------------------------tcccgaaggcaatcacgg
F7GVS7_BAD-04           --------------------------------------------------
F7GVS7_BAD-02           -------------------------------cgcccgaagagcgcgggca
F7GVS7_BAD-01           --------------------------------------------------
F7GVS7_BAD-03           gtctgccccagccactgactcagaagcccaacacgcagagaatgtaaagc
F7CM09_BMF-02           --------------------------------ccctgtggggtaactgag
F7FFP6_BBC3-03          --------------------------------ccccggggg---------

A0A1D5QGJ8_PMAIP1-      -------gatgcagctgcattacaccagaggcaaaaagctcgtctcctcc
A0A1D5R1E4_HRK-01       --------------------------------------gcgctccccacc
F7HHA9_BCL2L11-08       --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
F7HHA9_BCL2L11-03       aggtgaaggggacagctgcccccacggcagccctcagggcccgctggccc
F7HHA9_BCL2L11-02       aggtgaaggggacagctgcccccacggcagccctcagggcccgctggccc
F7HHA9_BCL2L11-04       aggtgaaggggacagctgcccccacggcagccctcagggcccgctggccc
F7HHA9_BCL2L11-06       aggtgaaggggacagctgcccccacggcagccctcagggcccgctggccc
F7HHA9_BCL2L11-01       aggtgaaggggacagctgcccccacggcagccctcagggcccgctggccc
F7GVS7_BAD-04           --------------------------------------------------
F7GVS7_BAD-02           cagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcc
F7GVS7_BAD-01           ---aggcgctggggctgtggagacccgg--agtcgccacagctcctaccc
F7GVS7_BAD-03           tgaaggcgctggggctgtggagacccgg--agtcgccacagctcctaccc
F7CM09_BMF-02           gaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
F7FFP6_BBC3-03          ---ccctggcg--------------------------ggcggtcccaccc

A0A1D5QGJ8_PMAIP1-      tccccacttgtccttccgcggggccacgaggaacaagtgcaagtagctcg
A0A1D5R1E4_HRK-01       tactggccc-----------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
F7HHA9_BCL2L11-05       ----ggctgaacctg-------------cagatatgcgccc---------
F7HHA9_BCL2L11-03       caccggccagccctggcccttttgctaccagatccccgcttttcatcttt
F7HHA9_BCL2L11-02       caccggccagccctggcccttttgctaccagatccccgcttttcatcttt
F7HHA9_BCL2L11-04       caccggccagccctggcccttttgctaccagatccccgcttttcatcttt
F7HHA9_BCL2L11-06       caccggccagccctggcccttttgctaccagatccccgcttttcatcttt
F7HHA9_BCL2L11-01       caccggccagccctggcccttttgctaccagatccccgcttttcatcttt
F7GVS7_BAD-04           -------------------------atggaggaggagcccagc-cccttt
F7GVS7_BAD-02           tggtgggatcg--------gaacttgggcaggggaagctccgcaccctcc
F7GVS7_BAD-01           cgcggggacggaggaggacgaagggatggaggaggagcccagc-cccttt
F7GVS7_BAD-03           cgcggggacggaggaggacgaagggatggaggaggagcccagc-cccttt
F7CM09_BMF-02           tgccagtttcccggcagtcttgcccatcggggagcagc------cccccg
F7FFP6_BBC3-03          aggcgg--ccccgggagtcc------gcggggag---------------g

A0A1D5QGJ8_PMAIP1-      aagtcgagtgtgctactcaactcaggagattt------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------gtctc-------
F7HHA9_BCL2L11-09       --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
F7HHA9_BCL2L11-05       ----ggagat----------------------------------------
F7HHA9_BCL2L11-03       atgagaagatcctccctgctgtctcgatcctccagtgggtatt-------
F7HHA9_BCL2L11-02       atgagaagatcctccctgctgtctcgatcctccagtgggtatt-------
F7HHA9_BCL2L11-04       atgagaagatcctccctgctgtctcgatcctccagtgggtatt-------
F7HHA9_BCL2L11-06       atgagaagatcctccctgctgtctcgatcctccagtgggtatt-------
F7HHA9_BCL2L11-01       atgagaagatcctccctgctgtctcgatcctccagtgggtatt-------
F7GVS7_BAD-04           cggggccgctcgcgctccgcgccc----------cccaacctc-------
F7GVS7_BAD-02           cagtgacctt--cgctccacgcccggaaactccacccgctctcactgtcc
F7GVS7_BAD-01           cggggccgctcgcgctccgcgccc----------cccaacctc-------
F7GVS7_BAD-03           cggggccgctcgcgctccgcgccc----------cccaacctc-------
F7CM09_BMF-02           aagggcagtg-------------------------gcaacatc-------
F7FFP6_BBC3-03          aggaacagtgggcc--------------------cgggagatc-------

A0A1D5QGJ8_PMAIP1-      ----------------------ggagacaaactgaacttccggcagaaac
A0A1D5R1E4_HRK-01       ---------------------------------------tggctgtgcgc
F7HHA9_BCL2L11-08       -------actctgttgcccaagctgg------ag-----tgcactggtac
F7HHA9_BCL2L11-09       ---------------------gacaggagcccag-----cacccatgagt
F7HHA9_BCL2L11-07       ---------------------gacaggagcccag-----cacccatgagt
F7HHA9_BCL2L11-05       ------------------acggat---------------cgcccaagagt
F7HHA9_BCL2L11-03       -------tctcttttgacacagacaggagcccag-----cacccatgagt
F7HHA9_BCL2L11-02       -------tctcttttgacacagacaggagcccag-----cacccatgagt
F7HHA9_BCL2L11-04       -------tctcttttgacacagacaggagcccag-----cacccatgagt
F7HHA9_BCL2L11-06       -------tctcttttgacacagacaggagcccag-----cacccatgagt
F7HHA9_BCL2L11-01       -------tctcttttgacacagacaggagcccag-----cacccatgagt
F7GVS7_BAD-04           -------------------tgggcagcacagcgt---tatggccgcgagc
F7GVS7_BAD-02           tggtcggccatcttggatatgggcggaagtgcttccctcaggccttatgc
F7GVS7_BAD-01           -------------------tgggcagcacagcgt---tatggccgcgagc
F7GVS7_BAD-03           -------------------tgggcagcacagcgt---tatggccgcgagc
F7CM09_BMF-02           --------------------gagcagaggtacag---attgcccgaaagc
F7FFP6_BBC3-03          --------------------ggg-----------------gccc---agc

A0A1D5QGJ8_PMAIP1-      ttctgaatctgatagccaaactcttctgctca------------------
A0A1D5R1E4_HRK-01       ggccgcgca--ggtggcggcgctggcggcctggctg--------------
F7HHA9_BCL2L11-08       tatcttggctc-actgcaacctccaactcccaagtt--------------
F7HHA9_BCL2L11-09       tgtgacaaatc-aacacaaaccccaagtcctccttg--------------
F7HHA9_BCL2L11-07       tgtgacaaatc-aacacaaaccccaagtcctccttg--------------
F7HHA9_BCL2L11-05       tgcggcgaatcggagacgagtttaacgcttactatg--------------
F7HHA9_BCL2L11-03       tgtgacaaatc-aacacaaaccccaagtcctccttg--------------
F7HHA9_BCL2L11-02       tgtgacaaatc-aacacaaaccccaagtcctccttg--------------
F7HHA9_BCL2L11-04       tgtgacaaatc-aacacaaaccccaagtcctccttg--------------
F7HHA9_BCL2L11-06       tgtgacaaatc-aacacaaaccccaagtcctccttg--------------
F7HHA9_BCL2L11-01       tgtgacaaatc-aacacaaaccccaagtcctccttg--------------
F7GVS7_BAD-04           tccggaggatgagtgacgagtttgtggactcctttaaggtgagcgccgga
F7GVS7_BAD-02           aaaagaggatccgtgctgcctctttcg-----------------------
F7GVS7_BAD-01           tccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgc
F7GVS7_BAD-03           tccggaggatga--------------------------------------
F7CM09_BMF-02           ttcagtgcattgcagaccagttccaccggctccatgtgcag---------
F7FFP6_BBC3-03          tgcggcggatggcggacgacctcaacgcgcaatacgagcgg---------

A0A1D5QGJ8_PMAIP1-      ---------ggaacctgactgcatcaaaaacttgcataaggggactccaa
A0A1D5R1E4_HRK-01       ---------ctcggcaggcggaacttg-----------------------
F7HHA9_BCL2L11-08       ---------caagcggtt---ctcctgcctcagcctccc-----------
F7HHA9_BCL2L11-09       ---------ccaggccttcaaccactatctcagtgcaatggtagtcatcc
F7HHA9_BCL2L11-07       ---------ccaggccttcaaccactatctcagtgcaatggatg------
F7HHA9_BCL2L11-05       ---------caaggaggttggcag--aactcctggcatcctccacctga-
F7HHA9_BCL2L11-03       ---------ccaggccttcaaccactatctcagtgcaatggtta------
F7HHA9_BCL2L11-02       ---------ccaggccttcaaccactatctcagtgcaatggcttccagga
F7HHA9_BCL2L11-04       ---------ccaggccttcaaccactatctcagtgcaatggcttccagga
F7HHA9_BCL2L11-06       ---------ccaggccttcaaccactatctcagtgcaatggctaactgg-
F7HHA9_BCL2L11-01       ---------ccaggccttcaaccactatctcagtgcaatgggtattttt-
F7GVS7_BAD-04           ccccctc--ccaggccgccccgcgccggtctgtcccttccttgtcccaag
F7GVS7_BAD-02           ---------gtgggagggctgacccagattc-------------------
F7GVS7_BAD-01           ccgaagagcgcgggcacagcgacgcagatgcggcaaagctccagctggac
F7GVS7_BAD-03           --------------------------------------------------
F7CM09_BMF-02           ---------------caacaccagcagaaccgaaatcgcgtgtgg---tg
F7FFP6_BBC3-03          ---------cggagacaagaggagcagcagcgacaccgcccctcgccctg

A0A1D5QGJ8_PMAIP1-      aagagactttttctcaggaggtgcacacttcatcaatttgaagaaagatt
A0A1D5R1E4_HRK-01       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
F7HHA9_BCL2L11-09       tagaggatataggtgatagttcattgtggtttggatttatatttactggc
F7HHA9_BCL2L11-07       ---------------------------------------aggccactgga
F7HHA9_BCL2L11-05       --------------------------------------------------
F7HHA9_BCL2L11-03       ---------------------------------------gagaaatag--
F7HHA9_BCL2L11-02       ggcaggctgaa----------cctgcagatatgcgcccggagatacggat
F7HHA9_BCL2L11-04       ggcaggctgaa----------cctgcagatatgcgcccggagatacggat
F7HHA9_BCL2L11-06       --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
F7GVS7_BAD-04           gc---acgt------ccggatctgatgtcccacgatccctccccaacgcc
F7GVS7_BAD-02           -----cctt------ccggtgcatgtga----------------------
F7GVS7_BAD-01           gcgagtctt------ccagtcctggtgggatcggaacttgggcaggggaa
F7GVS7_BAD-03           --------------------------------------------------
F7CM09_BMF-02           gcagatcct------cctcttcctgcacaaccttgctttgaatggagaac
F7FFP6_BBC3-03          gagggtcctgtacaatctcatcatgggactcctgcccttacccaggggcc

A0A1D5QGJ8_PMAIP1-      gcattgtaat----------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
F7HHA9_BCL2L11-09       ttagatttgtatggccaccaccacagtcaagatacagaacaactcaacca
F7HHA9_BCL2L11-07       tcctccctcggaattgcccttcatagggaagttcagtggccgctcgagtg
F7HHA9_BCL2L11-05       --------------------------------------------------
F7HHA9_BCL2L11-03       -------------------------------------------------a
F7HHA9_BCL2L11-02       cgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaa
F7HHA9_BCL2L11-04       cgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaa
F7HHA9_BCL2L11-06       --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
F7GVS7_BAD-04           gtcctgccccttcctagctccat---------------------------
F7GVS7_BAD-02           --------------------------------------------------
F7GVS7_BAD-01           gctccgcaccctcccagtga------------------------------
F7GVS7_BAD-03           --------------------------------------------------
F7CM09_BMF-02           agaacaggaacggggcgggccct---------------------------
F7FFP6_BBC3-03          acagagcccccgaaatggagccc---------------------------

A0A1D5QGJ8_PMAIP1-      --------------------------
A0A1D5R1E4_HRK-01       -----------------------tag
F7HHA9_BCL2L11-08       --------------------aagtag
F7HHA9_BCL2L11-09       caaggatttc----------tcatga
F7HHA9_BCL2L11-07       gtta----------------gcataa
F7HHA9_BCL2L11-05       --------------------------
F7HHA9_BCL2L11-03       ggaagttgtc----------gtgtag
F7HHA9_BCL2L11-02       ggaggatgtcgcttccacctgattaa
F7HHA9_BCL2L11-04       ggaggttagag---------aaatag
F7HHA9_BCL2L11-06       --------------------gactag
F7HHA9_BCL2L11-01       --------------------gaataa
F7GVS7_BAD-04           --------------------ag----
F7GVS7_BAD-02           --------------------------
F7GVS7_BAD-01           --------------------------
F7GVS7_BAD-03           --------------------------
F7CM09_BMF-02           --------------------aggtga
F7FFP6_BBC3-03          --------------------aattag

© 1998-2019