Dataset for CDS BCL2L11 of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F7HHA9_BCL2L11-08      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
F7HHA9_BCL2L11-09      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
F7HHA9_BCL2L11-07      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
F7HHA9_BCL2L11-05      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
F7HHA9_BCL2L11-03      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
F7HHA9_BCL2L11-02      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
F7HHA9_BCL2L11-04      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
F7HHA9_BCL2L11-06      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
F7HHA9_BCL2L11-01      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag

F7HHA9_BCL2L11-08      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
F7HHA9_BCL2L11-09      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
F7HHA9_BCL2L11-07      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
F7HHA9_BCL2L11-05      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
F7HHA9_BCL2L11-03      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
F7HHA9_BCL2L11-02      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
F7HHA9_BCL2L11-04      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
F7HHA9_BCL2L11-06      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
F7HHA9_BCL2L11-01      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta

F7HHA9_BCL2L11-08      cctccctacagacagagccacaa---------------------------
F7HHA9_BCL2L11-09      cctccctacagacagagccacaa---------------------------
F7HHA9_BCL2L11-07      cctccctacagacagagccacaa---------------------------
F7HHA9_BCL2L11-05      cctccctacagacagagccacaagct--tccaggaggca-----------
F7HHA9_BCL2L11-03      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F7HHA9_BCL2L11-02      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F7HHA9_BCL2L11-04      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F7HHA9_BCL2L11-06      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F7HHA9_BCL2L11-01      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt

F7HHA9_BCL2L11-08      --------------------------------------------------
F7HHA9_BCL2L11-09      --------------------------------------------------
F7HHA9_BCL2L11-07      --------------------------------------------------
F7HHA9_BCL2L11-05      --------------------------------------------------
F7HHA9_BCL2L11-03      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
F7HHA9_BCL2L11-02      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
F7HHA9_BCL2L11-04      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
F7HHA9_BCL2L11-06      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
F7HHA9_BCL2L11-01      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc

F7HHA9_BCL2L11-08      --------------------------------------------------
F7HHA9_BCL2L11-09      --------------------------------------------------
F7HHA9_BCL2L11-07      --------------------------------------------------
F7HHA9_BCL2L11-05      ggctgaacctg-------------cagatatgcgccc-------------
F7HHA9_BCL2L11-03      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
F7HHA9_BCL2L11-02      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
F7HHA9_BCL2L11-04      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
F7HHA9_BCL2L11-06      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
F7HHA9_BCL2L11-01      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga

F7HHA9_BCL2L11-08      ----------------------------------gtctcactctgttgcc
F7HHA9_BCL2L11-09      --------------------------------------------------
F7HHA9_BCL2L11-07      --------------------------------------------------
F7HHA9_BCL2L11-05      ggagat--------------------------------------------
F7HHA9_BCL2L11-03      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
F7HHA9_BCL2L11-02      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
F7HHA9_BCL2L11-04      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
F7HHA9_BCL2L11-06      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
F7HHA9_BCL2L11-01      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac

F7HHA9_BCL2L11-08      caagctgg------agtgcactggtactatcttggctc-actgcaacctc
F7HHA9_BCL2L11-09      ---gacaggagcccagcacccatgagttgtgacaaatc-aacacaaaccc
F7HHA9_BCL2L11-07      ---gacaggagcccagcacccatgagttgtgacaaatc-aacacaaaccc
F7HHA9_BCL2L11-05      acggat----------cgcccaagagttgcggcgaatcggagacgagttt
F7HHA9_BCL2L11-03      acagacaggagcccagcacccatgagttgtgacaaatc-aacacaaaccc
F7HHA9_BCL2L11-02      acagacaggagcccagcacccatgagttgtgacaaatc-aacacaaaccc
F7HHA9_BCL2L11-04      acagacaggagcccagcacccatgagttgtgacaaatc-aacacaaaccc
F7HHA9_BCL2L11-06      acagacaggagcccagcacccatgagttgtgacaaatc-aacacaaaccc
F7HHA9_BCL2L11-01      acagacaggagcccagcacccatgagttgtgacaaatc-aacacaaaccc
                          *              * *  *   *        **     * *    

F7HHA9_BCL2L11-08      caactcccaagttcaagcggtt---ctcctgcctcagcctccc-------
F7HHA9_BCL2L11-09      caagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtc
F7HHA9_BCL2L11-07      caagtcctccttgccaggccttcaaccactatctcagtgcaatggatg--
F7HHA9_BCL2L11-05      aacgcttactatgcaaggaggttggcag--aactcctggcatcctccacc
F7HHA9_BCL2L11-03      caagtcctccttgccaggccttcaaccactatctcagtgcaatggtta--
F7HHA9_BCL2L11-02      caagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcc
F7HHA9_BCL2L11-04      caagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcc
F7HHA9_BCL2L11-06      caagtcctccttgccaggccttcaaccactatctcagtgcaatggctaac
F7HHA9_BCL2L11-01      caagtcctccttgccaggccttcaaccactatctcagtgcaatgggtatt
                        *         * * **    *   *      ***               

F7HHA9_BCL2L11-08      --------------------------------------------------
F7HHA9_BCL2L11-09      atcctagaggatataggtgatagttcattgtggtttggatttatatttac
F7HHA9_BCL2L11-07      -------------------------------------------aggccac
F7HHA9_BCL2L11-05      tga-----------------------------------------------
F7HHA9_BCL2L11-03      -------------------------------------------gagaaat
F7HHA9_BCL2L11-02      aggaggcaggctgaa----------cctgcagatatgcgcccggagatac
F7HHA9_BCL2L11-04      aggaggcaggctgaa----------cctgcagatatgcgcccggagatac
F7HHA9_BCL2L11-06      tgg-----------------------------------------------
F7HHA9_BCL2L11-01      ttt-----------------------------------------------

F7HHA9_BCL2L11-08      --------------------------------------------------
F7HHA9_BCL2L11-09      tggcttagatttgtatggccaccaccacagtcaagatacagaacaactca
F7HHA9_BCL2L11-07      tggatcctccctcggaattgcccttcatagggaagttcagtggccgctcg
F7HHA9_BCL2L11-05      --------------------------------------------------
F7HHA9_BCL2L11-03      ag------------------------------------------------
F7HHA9_BCL2L11-02      ggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactat
F7HHA9_BCL2L11-04      ggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactat
F7HHA9_BCL2L11-06      --------------------------------------------------
F7HHA9_BCL2L11-01      --------------------------------------------------

F7HHA9_BCL2L11-08      ------------------------aagtag
F7HHA9_BCL2L11-09      accacaaggatttc----------tcatga
F7HHA9_BCL2L11-07      agtggtta----------------gcataa
F7HHA9_BCL2L11-05      ------------------------------
F7HHA9_BCL2L11-03      ---aggaagttgtc----------gtgtag
F7HHA9_BCL2L11-02      gcaaggaggatgtcgcttccacctgattaa
F7HHA9_BCL2L11-04      gcaaggaggttagag---------aaatag
F7HHA9_BCL2L11-06      ------------------------gactag
F7HHA9_BCL2L11-01      ------------------------gaataa

© 1998-2019