Dataset for CDS BAD of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7GVS7_BAD-04      ------------------------------------------------------------
F7GVS7_BAD-02      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagagg
F7GVS7_BAD-01      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagagg
F7GVS7_BAD-03      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagagg
                                                                               

F7GVS7_BAD-04      ------------------------------------------------------------
F7GVS7_BAD-02      ggcctgggccccagccccgcgggggacaggccctcagactccggcaagcatcatcgccag
F7GVS7_BAD-01      ggcctgggccccagccccgcgggggacaggccctcagactccggcaagcatcatcgccag
F7GVS7_BAD-03      ggcctgggccccagccccgcgggggacaggccctcagactccggcaagcatcatcgccag
                                                                               

F7GVS7_BAD-04      ------------------------------------------------------------
F7GVS7_BAD-02      gccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccat
F7GVS7_BAD-01      gccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccat
F7GVS7_BAD-03      gccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccat
                                                                               

F7GVS7_BAD-04      ------------------------------------------------------------
F7GVS7_BAD-02      catggagggacttcct--------------------------------------------
F7GVS7_BAD-01      catgg-------------------------------------------------------
F7GVS7_BAD-03      catggagggagagcttggtattctccttcttgggaatctgaggactctgaaaatcccagt
                                                                               

F7GVS7_BAD-04      ------------------------------------------------------------
F7GVS7_BAD-02      ------------------------------------------------------------
F7GVS7_BAD-01      ------------------------------------------------------------
F7GVS7_BAD-03      gcaaggatgctcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcc
                                                                               

F7GVS7_BAD-04      ------------------------------------------------------------
F7GVS7_BAD-02      ---cgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctccagctggacgcga
F7GVS7_BAD-01      -------------------------aggcgctggggctgtggagacccgg--agtcgcca
F7GVS7_BAD-03      caacacgcagagaatgtaaagctgaaggcgctggggctgtggagacccgg--agtcgcca
                                                                               

F7GVS7_BAD-04      -------------------------------------atggaggaggagcccagc-ccct
F7GVS7_BAD-02      gtcttccagtcctggtgggatcg--------gaacttgggcaggggaagctccgcaccct
F7GVS7_BAD-01      cagctcctaccccgcggggacggaggaggacgaagggatggaggaggagcccagc-ccct
F7GVS7_BAD-03      cagctcctaccccgcggggacggaggaggacgaagggatggaggaggagcccagc-ccct
                                                          * *** * *** * ** ****

F7GVS7_BAD-04      ttcggggccgctcgcgctccgcgccc----------cccaacctc---------------
F7GVS7_BAD-02      cccagtgacctt--cgctccacgcccggaaactccacccgctctcactgtcctggtcggc
F7GVS7_BAD-01      ttcggggccgctcgcgctccgcgccc----------cccaacctc---------------
F7GVS7_BAD-03      ttcggggccgctcgcgctccgcgccc----------cccaacctc---------------
                     * * * *  *  ****** *****          ***   ***               

F7GVS7_BAD-04      -----------tgggcagcacagcgt---tatggccgcgagctccggaggatgagtgacg
F7GVS7_BAD-02      catcttggatatgggcggaagtgcttccctcaggccttatgcaaaagaggatccgtgctg
F7GVS7_BAD-01      -----------tgggcagcacagcgt---tatggccgcgagctccggaggatgagtgacg
F7GVS7_BAD-03      -----------tgggcagcacagcgt---tatggccgcgagctccggaggatga------
                              ***** * *  ** *   *  ****    **    ******        

F7GVS7_BAD-04      agtttgtggactcctttaaggtgagcgccggaccccctc--ccaggccgccccgcgccgg
F7GVS7_BAD-02      cctctttcg--------------------------------gtgggagggctgacccaga
F7GVS7_BAD-01      agtttgtggactcctttaagggacttcctcgcccgaagagcgcgggcacagcgacgcaga
F7GVS7_BAD-03      ------------------------------------------------------------
                                                                               

F7GVS7_BAD-04      tctgtcccttccttgtcccaaggc---acgtccggatctgatgtcccacgatccctcccc
F7GVS7_BAD-02      ttc------------------------ccttccggtgcatgtga----------------
F7GVS7_BAD-01      tgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggca
F7GVS7_BAD-03      ------------------------------------------------------------
                                                                               

F7GVS7_BAD-04      aacgccgtcctgccccttcctagctccatag
F7GVS7_BAD-02      -------------------------------
F7GVS7_BAD-01      ggggaagctccgcaccctcccagtga-----
F7GVS7_BAD-03      -------------------------------
                                                  

© 1998-2018