Dataset for CDS classical BH3-containing proteins of organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

20 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5VPX2_PMAIP1-      atg------------cctgggaagaaggc---------------------
A0A2K5VPX2_PMAIP1-      atg------------cctgggaagaaggc---------------------
A0A2K5VW94_BIK-01       atg------------tctggagtaagacccatctccagagacaccttgat
A0A2K5X2I7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------ccgaga
A0A2K5X2I7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------ccgaga
A0A2K5X2I7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------ccgaga
A0A2K5X2I7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------ccgaga
A0A2K5X2I7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------ccgaga
A0A2K5X2I7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------ccgaga
A0A2K5X2I7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------ccgaga
A0A2K5X2I7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------ccgaga
A0A2K5X2I7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------ccgaga
A0A2K5X2I7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtga------ccgaga
A0A2K5VCD8_BAD-02       atgttccaga----tcccagagtttgagcctagtg-ag------caggaa
A0A2K5VCD8_BAD-03       atgttccaga----tcccagagtttgagcctagtg-ag------caggaa
A0A2K5VCD8_BAD-01       atgttccaga----tcccagagtttgagcctagtg-ag------caggaa
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5V8J3_BBC3-03      ataaaa---------tttggcgtggggtctgcccg------------ggc
G7PAW6_BMF-02           atggagcc-a----tctcggtgtgtggaggagctggag------gatgat
G7PAW6_BMF-01           atggagcc-a----tctcggtgtgtggaggagctggag------gatgat

A0A2K5VPX2_PMAIP1-      ----------------gcgcaagaacgcgcaaccgagcccaacgcggg--
A0A2K5VPX2_PMAIP1-      ----------------gcgcaagaacgcgcaaccgagcccaacgcggg--
A0A2K5VW94_BIK-01       ggagaccctcctgtatgagcagctcctggaaccc---ctaaccatggagg
A0A2K5X2I7_BCL2L11      aggtagacaattgca-gcctgcggagaggcctcc----------------
A0A2K5X2I7_BCL2L11      aggtagacaattgca-gcctgcggagaggcctcc----------------
A0A2K5X2I7_BCL2L11      aggtagacaattgca-gcctgcggagaggcctcc----------------
A0A2K5X2I7_BCL2L11      aggtagacaattgca-gcctgcggagaggcctcc----------------
A0A2K5X2I7_BCL2L11      aggtagacaattgca-gcctgcggagaggcctcc----------------
A0A2K5X2I7_BCL2L11      aggtagacaattgca-gcctgcggagaggcctcc----------------
A0A2K5X2I7_BCL2L11      aggtagacaattgca-gcctgcggagaggcctcc----------------
A0A2K5X2I7_BCL2L11      aggtagacaattgca-gcctgcggagaggcctcc----------------
A0A2K5X2I7_BCL2L11      aggtagacaattgca-gcctgcggagaggcctcc----------------
A0A2K5X2I7_BCL2L11      aggtagacaattgca-gcctgcggagaggcctcc----------------
A0A2K5VCD8_BAD-02       gactccagctctgca-gagaggggcctgggcccc---agccccgcggg--
A0A2K5VCD8_BAD-03       gactccagctctgca-gagaggggcctgggcccc---agccccgcggg--
A0A2K5VCD8_BAD-01       gactccagctctgca-gagaggggcctgggcccc---agccccgcggg--
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5V8J3_BBC3-03      atgtccatgccaggt-gcc------cagggcttcttctgcgacgtggg--
G7PAW6_BMF-02           gtgttccagccggag-gacggggagccggggtcc-----caacccgggag
G7PAW6_BMF-01           gtgttccagccggag-gacggggagccggggtcc-----caacccgggag

A0A2K5VPX2_PMAIP1-      ------ctcaggcaggacagg----cagggacggcagggacggcgaggga
A0A2K5VPX2_PMAIP1-      ------ctcaggcag-----------------------------------
A0A2K5VW94_BIK-01       ttcttggtgtcactgaccctgaagaggacctggacc--------------
A0A2K5X2I7_BCL2L11      ------ccagctcagacctgg----ggcc-----cctacctccctacaga
A0A2K5X2I7_BCL2L11      ------ccagctcagacctgg----ggcc-----cctacctccctacaga
A0A2K5X2I7_BCL2L11      ------ccagctcagacctgg----ggcc-----cctacctccctacaga
A0A2K5X2I7_BCL2L11      ------ccagctcagacctgg----ggcc-----cctacctccctacaga
A0A2K5X2I7_BCL2L11      ------ccagctcagacctgg----ggcc-----cctacctccctacaga
A0A2K5X2I7_BCL2L11      ------ccagctcagacctgg----ggcc-----cctacctccctacaga
A0A2K5X2I7_BCL2L11      ------ccagctcagacctgg----ggcc-----cctacctccctacaga
A0A2K5X2I7_BCL2L11      ------ccagctcagacctgg----ggcc-----cctacctccctacaga
A0A2K5X2I7_BCL2L11      ------ccagctcagacctgg----ggcc-----cctacctccctacaga
A0A2K5X2I7_BCL2L11      ------ccagctcagacctgg----ggcc-----cctacctccctacaga
A0A2K5VCD8_BAD-02       ---------ggacaggccctc----agactccggcaagcatcatcgccag
A0A2K5VCD8_BAD-03       ---------ggacaggccctc----agactccggcaagcatcatcgccag
A0A2K5VCD8_BAD-01       ---------ggacaggccctc----agactccggcaagcatcatcgccag
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5V8J3_BBC3-03      ----tcccctgccagatttgt----ggtcctcagccctcgctcttgctgg
G7PAW6_BMF-02           ctctctctctgccgatctgtt----tgcccagagcctacttgactgcccc
G7PAW6_BMF-01           ctctctctctgccgatctgtt----tgcccagagcctacttgactgcccc

A0A2K5VPX2_PMAIP1-      ccaggccggatttgggattgggatgcagctgcattacaccagaggcaaaa
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VW94_BIK-01       ctatggaggacttcaat---------------------------------
A0A2K5X2I7_BCL2L11      caga-----gccacaag---------------------------------
A0A2K5X2I7_BCL2L11      caga-----gccacaag---------------------------------
A0A2K5X2I7_BCL2L11      caga-----gccacaag---------------------------------
A0A2K5X2I7_BCL2L11      caga-----gccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5X2I7_BCL2L11      caga-----gccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5X2I7_BCL2L11      caga-----gccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5X2I7_BCL2L11      caga-----gccaca-----------------------------------
A0A2K5X2I7_BCL2L11      caga-----gccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5X2I7_BCL2L11      caga-----gccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5X2I7_BCL2L11      caga-----gccacaaggtaatcccgaaggcaatcacggaggtgaagggg
A0A2K5VCD8_BAD-02       ---------gccccagg---------------------------------
A0A2K5VCD8_BAD-03       ---------gccccagg---------------------------------
A0A2K5VCD8_BAD-01       ---------gccccagg---------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5V8J3_BBC3-03      cggagcagcacctggag---------------------------------
G7PAW6_BMF-02           ctcagccg-acttcagc---------------------------------
G7PAW6_BMF-01           ctcagccg-acttcagc---------------------------------

A0A2K5VPX2_PMAIP1-      agctcgtc--------tcctcctccccacttgtccttccgcggggcca--
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VW94_BIK-01       ---cctttggagtgtatggaggacagtgacatgttggccctgcggctggc
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      acagctgc----ccccacggcagccctcagggcccgctggccccaccggc
A0A2K5X2I7_BCL2L11      acagctgc----ccccacggcagccctcagggcccgctggccccaccggc
A0A2K5X2I7_BCL2L11      acagctgc----ccccacggcagccctcagggcccgctggccccaccggc
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      acagctgc----ccccacggcagccctcagggcccgctggccccaccggc
A0A2K5X2I7_BCL2L11      acagctgc----ccccacggcagccctcagggcccgctggccccaccggc
A0A2K5X2I7_BCL2L11      acagctgc----ccccacggcagccctcagggcccgctggccccaccggc
A0A2K5VCD8_BAD-02       ---cctcc----tgtg----ggacgccagtcaccagcaggagcagccaac
A0A2K5VCD8_BAD-03       ---cctcc----tgtg----ggacgccagtcaccagcaggagcagccaac
A0A2K5VCD8_BAD-01       ---cctcc----tgtg----ggacgccagtcaccagcaggagcagccaac
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5V8J3_BBC3-03      ---tcgcc----cgtgcccagcgccccgggggccctggcgggcggtc--c
G7PAW6_BMF-02           ---tcttc----cctctcacccactgctgtggccctggccttcgacccac
G7PAW6_BMF-01           ---tcttc----cctctcacccactgctgtggccctggccttcgacccac

A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VW94_BIK-01       ctgcatcggg----------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      cagccctggcccttttgctaccagatccccgcttttcatctttatgagaa
A0A2K5X2I7_BCL2L11      cagccctggcccttttgctaccagatccccgcttttcatctttatgagaa
A0A2K5X2I7_BCL2L11      cagccctggcccttttgctaccagatccccgcttttcatctttatgagaa
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      cagccctggcccttttgctaccagatccccgcttttcatctttatgagaa
A0A2K5X2I7_BCL2L11      cagccctggcccttttgctaccagatccccgcttttcatctttatgagaa
A0A2K5X2I7_BCL2L11      cagccctggcccttttgctaccagatccccgcttttcatctttatgagaa
A0A2K5VCD8_BAD-02       cagcagcagccatcatggagggacttcct---------------------
A0A2K5VCD8_BAD-03       cagcagcagccatcatggagggagagcttggtattctccttcttgggaat
A0A2K5VCD8_BAD-01       cagcagcagccatcatgg--------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5V8J3_BBC3-03      cacc----------------------------------------------
G7PAW6_BMF-02           cagc----------------------------------------------
G7PAW6_BMF-01           cagc----------------------------------------------

A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      gatc----------------------------------------------
A0A2K5X2I7_BCL2L11      gatc----------------------------------------------
A0A2K5X2I7_BCL2L11      gatc----------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      gatc----------------------------------------------
A0A2K5X2I7_BCL2L11      gatc----------------------------------------------
A0A2K5X2I7_BCL2L11      gatc----------------------------------------------
A0A2K5VCD8_BAD-02       --------------------------------------------------
A0A2K5VCD8_BAD-03       ctgaggactctgaaaatcccagtgcaaggatgctcgcggaagcatcagca
A0A2K5VCD8_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
G7PAW6_BMF-02           --------------------------------------------------
G7PAW6_BMF-01           --------------------------------------------------

A0A2K5VPX2_PMAIP1-      ------------------------------------cgaggaacaagtgc
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VW94_BIK-01       ------------------------------------gacgagatggatgt
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      ------------------------------------ctccctgctgtctc
A0A2K5X2I7_BCL2L11      ------------------------------------ctccctgctgtctc
A0A2K5X2I7_BCL2L11      ------------------------------------ctccctgctgtctc
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      ------------------------------------ctccctgctgtctc
A0A2K5X2I7_BCL2L11      ------------------------------------ctccctgctgtctc
A0A2K5X2I7_BCL2L11      ------------------------------------ctccctgctgtctc
A0A2K5VCD8_BAD-02       ------------------------------------cgcccgaagagcgc
A0A2K5VCD8_BAD-03       cggatgtctgccccagccactgactcagaagcccaacacgcagagaatgt
A0A2K5VCD8_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5V8J3_BBC3-03      ------------------------------------caggcggccccggg
G7PAW6_BMF-02           ------------------------------------caggaagacaaggc
G7PAW6_BMF-01           ------------------------------------caggaagacaaggc

A0A2K5VPX2_PMAIP1-      aagtagctcgaagtcgagtgtgct--------------------------
A0A2K5VPX2_PMAIP1-      ----agctcgaagtcgagtgtgct--------------------------
A0A2K5VW94_BIK-01       gagcctcagggccccgcgcct-----ggcccagctctctgaggtggccat
A0A2K5X2I7_BCL2L11      ----------------------------------------acagga----
A0A2K5X2I7_BCL2L11      ----------------------------------------acagga----
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      gatcctccagtgggtatttctcttttgacacag-------acagga----
A0A2K5X2I7_BCL2L11      gatcctccagtgggtatttctcttttgacacag-------acagga----
A0A2K5X2I7_BCL2L11      gatcctccagtgggtatttctcttttgacacag-------acagga----
A0A2K5X2I7_BCL2L11      -------------------------------ag-------acagga----
A0A2K5X2I7_BCL2L11      gatcctccagtgggtatttctcttttgacacag-------acagga----
A0A2K5X2I7_BCL2L11      gatcctccagtgggtatttctcttttgacacag-------acagga----
A0A2K5X2I7_BCL2L11      gatcctccagtgggtatttctcttttgacacag-------acagga----
A0A2K5VCD8_BAD-02       gggcacagcgacgcagatgcggcaaagctccagctggacgcgagtc----
A0A2K5VCD8_BAD-03       aaagctgaaggcgctggggctgtggagacccgg--agtcgccacag----
A0A2K5VCD8_BAD-01       --------aggcgctggggctgtggagacccgg--agtcgccacag----
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5V8J3_BBC3-03      agtccgcggggaggaggaacagtg--ggcccgggagatc----ggg----
G7PAW6_BMF-02           caccc-----------agaccctc--ggcccag-----c----ctc----
G7PAW6_BMF-01           caccc-----------agaccctc--ggcccag-----c----ctc----

A0A2K5VPX2_PMAIP1-      actcaactcaggag----atttggagacaaactgaacttccggcagaaac
A0A2K5VPX2_PMAIP1-      actcaactcaggag----atttggagacaaactgaacttccggcagaaac
A0A2K5VW94_BIK-01       gcacagcctgggtctggctttcatctacgaccagat------ggacgaca
A0A2K5X2I7_BCL2L11      gcccagcacccatg----------agttgtgacaaa---tcaacacaaac
A0A2K5X2I7_BCL2L11      gcccagcacccatg----------agttgtgacaaa---tcaacacaaac
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      gcccagcacccatg----------agttgtgacaaa---tcaacacaaac
A0A2K5X2I7_BCL2L11      gcccagcacccatg----------agttgtgacaaa---tcaacacaaac
A0A2K5X2I7_BCL2L11      gcccagcacccatg----------agttgtgacaaa---tcaacacaaac
A0A2K5X2I7_BCL2L11      gcccagcacccatg----------agttgtgacaaa---tcaacacaaac
A0A2K5X2I7_BCL2L11      gcccagcacccatg----------agttgtgacaaa---tcaacacaaac
A0A2K5X2I7_BCL2L11      gcccagcacccatg----------agttgtgacaaa---tcaacacaaac
A0A2K5X2I7_BCL2L11      gcccagcacccatg----------agttgtgacaaa---tcaacacaaac
A0A2K5VCD8_BAD-02       ttccagtcctggtgggatcg--------gaacttgg---gcaggggaagc
A0A2K5VCD8_BAD-03       ctcctaccccgcggggacggaggaggacgaagggat---ggaggaggagc
A0A2K5VCD8_BAD-01       ctcctaccccgcggggacggaggaggacgaagggat---ggaggaggagc
Q2PG01_BAD-01           ----------------------------------at---ggaggaggagc
A0A2K5V8J3_BBC3-03      gcccagctgcggcg----gatggcggacgacctcaa---cgcgca--ata
G7PAW6_BMF-02           ccccagccaaggtgtcatgctgccctgtggggtaac---tgagga--acc
G7PAW6_BMF-01           ccccagccaaggtgtcatgctgccctgtggggtaac---tgagga--acc

A0A2K5VPX2_PMAIP1-      ttctgaatctgatagccaaact-------------------cttctgct-
A0A2K5VPX2_PMAIP1-      ttctgaatctgatagccaaact-------------------cttctgct-
A0A2K5VW94_BIK-01       tcagggatgttcttagaagtttcatggatg-----------gtttcacca
A0A2K5X2I7_BCL2L11      cccaagtcctccttgccaggc--------------------cttcaacca
A0A2K5X2I7_BCL2L11      cccaagtcctccttgccaggc--------------------cttcaacca
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      cccaagtcctccttgccaggc--------------------cttcaacca
A0A2K5X2I7_BCL2L11      cccaagtcctccttgccaggc--------------------cttcaacca
A0A2K5X2I7_BCL2L11      cccaagtcctccttgccaggc--------------------cttcaacca
A0A2K5X2I7_BCL2L11      cccaagtcctccttgccaggc--------------------cttcaacca
A0A2K5X2I7_BCL2L11      cccaagtcctccttgccaggc--------------------cttcaacca
A0A2K5X2I7_BCL2L11      cccaagtcctccttgccaggc--------------------cttcaacca
A0A2K5X2I7_BCL2L11      cccaagtcctccttgccaggc--------------------cttcaacca
A0A2K5VCD8_BAD-02       tccgcaccctcccagtgacctt--cgctccacgcccggaaactccacccg
A0A2K5VCD8_BAD-03       ccagc-ccctttcggggccgctcgcgctccgcgcc------ccccaacct
A0A2K5VCD8_BAD-01       ccagc-ccctttcggggccgctcgcgctccgcgcc------ccccaacct
Q2PG01_BAD-01           ccagc-ccctttcggggccgctcgcgctccgcgcc------ccccaacct
A0A2K5V8J3_BBC3-03      cgagcggc------------------------------------------
G7PAW6_BMF-02           ccagcgactcttttacggcaatgctggctaccggcttcctctccctgcca
G7PAW6_BMF-01           ccagcgactcttttacg---------------------------------

A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VW94_BIK-01       ccct----------------------------------------------
A0A2K5X2I7_BCL2L11      ctatct--------------------------------------------
A0A2K5X2I7_BCL2L11      ctatct--------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      ctatct--------------------------------------------
A0A2K5X2I7_BCL2L11      ctatct--------------------------------------------
A0A2K5X2I7_BCL2L11      ctatct--------------------------------------------
A0A2K5X2I7_BCL2L11      ctatct--------------------------------------------
A0A2K5X2I7_BCL2L11      ctatct--------------------------------------------
A0A2K5X2I7_BCL2L11      ctatct--------------------------------------------
A0A2K5X2I7_BCL2L11      ctatct--------------------------------------------
A0A2K5VCD8_BAD-02       ct------------------------------------------------
A0A2K5VCD8_BAD-03       ct------------------------------------------------
A0A2K5VCD8_BAD-01       ct------------------------------------------------
Q2PG01_BAD-01           ct------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
G7PAW6_BMF-02           gtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtgg
G7PAW6_BMF-01           --------------------------------------------------

A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5VCD8_BAD-02       --------------------------------------------------
A0A2K5VCD8_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
G7PAW6_BMF-02           caacatcgagcagaggtacagattgcccgaaagcttcagtgcattgcaga
G7PAW6_BMF-01           --------------------------------------------------

A0A2K5VPX2_PMAIP1-      -------------------------------------caggaacctgact
A0A2K5VPX2_PMAIP1-      -------------------------------------caggaacctga--
A0A2K5VW94_BIK-01       -------------------------------------tagggagaacata
A0A2K5X2I7_BCL2L11      -------------------------------------cagtgcaatggta
A0A2K5X2I7_BCL2L11      -------------------------------------cagtgcaatgg--
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      -------------------------------------cagtgcaatgg--
A0A2K5X2I7_BCL2L11      -------------------------------------cagtgcaat----
A0A2K5X2I7_BCL2L11      -------------------------------------cagtgcaatgg--
A0A2K5X2I7_BCL2L11      -------------------------------------cagtgcaatgg--
A0A2K5X2I7_BCL2L11      -------------------------------------cagtgcaatgg--
A0A2K5X2I7_BCL2L11      -------------------------------------cagtgcaatgg--
A0A2K5X2I7_BCL2L11      -------------------------------------cagtgcaatgg--
A0A2K5VCD8_BAD-02       ----------------------------------ct-cactgtcctggtc
A0A2K5VCD8_BAD-03       ----------------------------gggcagca-cagcgttatggcc
A0A2K5VCD8_BAD-01       ----------------------------gggcagca-cagcgttatggcc
Q2PG01_BAD-01           ----------------------------gggcagca-cagcgttatggcc
A0A2K5V8J3_BBC3-03      --------------------ggagacaagaggagcagcagcgacaccgcc
G7PAW6_BMF-02           ccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcg
G7PAW6_BMF-01           ----------------------------caccagcagaaccgaaatcgcg

A0A2K5VPX2_PMAIP1-      gc------------------------------atcaaaaacttgcataag
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VW94_BIK-01       atgaggttctggagatccccgaatcccaggtcctgggtgtcccgtgaaca
A0A2K5X2I7_BCL2L11      gtcatcctagaggatataggtgatagttcattgtggtttggatttatatt
A0A2K5X2I7_BCL2L11      --at-----gag--------------------gccactggatcct-----
A0A2K5X2I7_BCL2L11      --cttccaggag--------------------gcaggctgaacctgcaga
A0A2K5X2I7_BCL2L11      --tt----------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --cttccaggag--------------------gcaggctgaacctgcaga
A0A2K5X2I7_BCL2L11      --cttccaggag--------------------gcaggctgaacctgcaga
A0A2K5X2I7_BCL2L11      --cttccaggag--------------------gcaggctgaacctgcaga
A0A2K5X2I7_BCL2L11      --cttccaggag--------------------gcaggctgaacctgcaga
A0A2K5X2I7_BCL2L11      --ctaactgg----------------------------------------
A0A2K5VCD8_BAD-02       g-gccatcttggat------------------atgggcg-----------
A0A2K5VCD8_BAD-03       gcgagctccggagg------------------atga--------------
A0A2K5VCD8_BAD-01       gcgagctccggagg------------------atgagtgacgagtttgtg
Q2PG01_BAD-01           gcgagctccggagg------------------atgagtgacgagtttgtg
A0A2K5V8J3_BBC3-03      cctcgccctggagg------------------gt----------cctgta
G7PAW6_BMF-02           tgtgg---tggcag------------------at----------cct---
G7PAW6_BMF-01           tgtgg---tggcag------------------at----------cct---

A0A2K5VPX2_PMAIP1-      gggactccaaaagagactttttctc------aggaggtgcacacttcatc
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VW94_BIK-01       ggtgctgctggtgctgctgctgctgctggcactgctgctggcgctgctca
A0A2K5X2I7_BCL2L11      tactggcttagatttgtatggccacc--------------accacagtca
A0A2K5X2I7_BCL2L11      ----ccctcgga-------attgccc--------------ttcataggga
A0A2K5X2I7_BCL2L11      tatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacg
A0A2K5X2I7_BCL2L11      ---------agagaaatag-------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      tatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacg
A0A2K5X2I7_BCL2L11      tatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacg
A0A2K5X2I7_BCL2L11      tatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacg
A0A2K5X2I7_BCL2L11      tatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacg
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K5VCD8_BAD-02       ---------gaagtgcttccct----------------------------
A0A2K5VCD8_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-01       gactcctttaagggacttcctcgcccgaagagcgcgggcacagcgacgca
Q2PG01_BAD-01           gactcctttaaggggcttcctcgcccgaagagcgcgggcacagcgacgca
A0A2K5V8J3_BBC3-03      caatctcatcatgggactcctgccctt----acccaggggccacagagcc
G7PAW6_BMF-02           ---cctcttcctgcacaaccttgcttt----gaatggagaagagaacagg
G7PAW6_BMF-01           ---cctcttcctgcacaaccttgcttt----gaatggagaagagaacagg

A0A2K5VPX2_PMAIP1-      aatttgaagaaagattgcattgtaattgg---------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VW94_BIK-01       gcgggggcctgcacctgctgctcaagtga---------------------
A0A2K5X2I7_BCL2L11      agatacag--------aacaactcaaccacaaggatttc----------t
A0A2K5X2I7_BCL2L11      agttcagt--------ggccgctc----gagtggttagcatca------a
A0A2K5X2I7_BCL2L11      agtttaac--------gcttactatgcaaggaggttg------------g
A0A2K5X2I7_BCL2L11      ----------------------------aggaagttgtc----------g
A0A2K5X2I7_BCL2L11      --------------------------------gggtattttt-------g
A0A2K5X2I7_BCL2L11      agtttaac--------gcttactatgcaaggagggtattttt-------g
A0A2K5X2I7_BCL2L11      agtttaac--------gcttactatgcaaggagggtattttt-------g
A0A2K5X2I7_BCL2L11      agtttaac--------gcttactatgcaaggaggatgtcgcttccacctg
A0A2K5X2I7_BCL2L11      agtttaac--------gcttactatgcaaggaggttagag---------a
A0A2K5X2I7_BCL2L11      -------------------------------------------------g
A0A2K5VCD8_BAD-02       -------c--------aggccttatgcaaaagaggatccgtgctgcctct
A0A2K5VCD8_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-01       gatgcggc--------aaagctccagctggacgcgagtcttccagtcctg
Q2PG01_BAD-01           gatgcggc--------aaagctccagctggacgcgagtcttccagtcctg
A0A2K5V8J3_BBC3-03      cccgaaat--------ggagcccaattag---------------------
G7PAW6_BMF-02           aacggggc--------gggccctaggtga---------------------
G7PAW6_BMF-01           aacggggc--------gggccctag-------------------------

A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K5X2I7_BCL2L11      catga---------------------------------------------
A0A2K5X2I7_BCL2L11      gctaa---------------------------------------------
A0A2K5X2I7_BCL2L11      cagaa---------------------------------------------
A0A2K5X2I7_BCL2L11      tgtag---------------------------------------------
A0A2K5X2I7_BCL2L11      aataa---------------------------------------------
A0A2K5X2I7_BCL2L11      aataattaccaagcagccgaagaccacccacaaatggttatcttacgact
A0A2K5X2I7_BCL2L11      aataattaccaagcagccgaagaccacccacaaatggttatcttacgact
A0A2K5X2I7_BCL2L11      attaa---------------------------------------------
A0A2K5X2I7_BCL2L11      aatag---------------------------------------------
A0A2K5X2I7_BCL2L11      actag---------------------------------------------
A0A2K5VCD8_BAD-02       ttcgg---------tgggagggctgacccagattcccttccggtgcatgt
A0A2K5VCD8_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-01       gtgggatcggaacttgggcaggggaagctccgcaccctcccagtga----
Q2PG01_BAD-01           gtgggatcggaacttgggcaggggaagctccgcaccctcccagtga----
A0A2K5V8J3_BBC3-03      --------------------------------------------------
G7PAW6_BMF-02           --------------------------------------------------
G7PAW6_BMF-01           --------------------------------------------------

A0A2K5VPX2_PMAIP1-      ----------------------------------------
A0A2K5VPX2_PMAIP1-      ----------------------------------------
A0A2K5VW94_BIK-01       ----------------------------------------
A0A2K5X2I7_BCL2L11      ----------------------------------------
A0A2K5X2I7_BCL2L11      ----------------------------------------
A0A2K5X2I7_BCL2L11      --ctcctggcatcctccacctga-----------------
A0A2K5X2I7_BCL2L11      ----------------------------------------
A0A2K5X2I7_BCL2L11      ----------------------------------------
A0A2K5X2I7_BCL2L11      gttgcgttacattgtccgcctggtgtggagaatgcattga
A0A2K5X2I7_BCL2L11      gttgcgttacattgtccgcctggtgtggagaatgcattga
A0A2K5X2I7_BCL2L11      ----------------------------------------
A0A2K5X2I7_BCL2L11      ----------------------------------------
A0A2K5X2I7_BCL2L11      ----------------------------------------
A0A2K5VCD8_BAD-02       ga--------------------------------------
A0A2K5VCD8_BAD-03       ----------------------------------------
A0A2K5VCD8_BAD-01       ----------------------------------------
Q2PG01_BAD-01           ----------------------------------------
A0A2K5V8J3_BBC3-03      ----------------------------------------
G7PAW6_BMF-02           ----------------------------------------
G7PAW6_BMF-01           ----------------------------------------

© 1998-2019