Dataset for CDS BMF of organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G7PAW6_BMF-01      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggg
G7PAW6_BMF-02      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggg
                   ************************************************************

G7PAW6_BMF-01      gagccggggtcccaacccgggagctctctctctgccgatctgtttgcccagagcctactt
G7PAW6_BMF-02      gagccggggtcccaacccgggagctctctctctgccgatctgtttgcccagagcctactt
                   ************************************************************

G7PAW6_BMF-01      gactgccccctcagccgacttcagctcttccctctcacccactgctgtggccctggcctt
G7PAW6_BMF-02      gactgccccctcagccgacttcagctcttccctctcacccactgctgtggccctggcctt
                   ************************************************************

G7PAW6_BMF-01      cgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
G7PAW6_BMF-02      cgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
                   ************************************************************

G7PAW6_BMF-01      ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacg--------
G7PAW6_BMF-02      ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgct
                   ****************************************************        

G7PAW6_BMF-01      ------------------------------------------------------------
G7PAW6_BMF-02      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcggggagcagccc
                                                                               

G7PAW6_BMF-01      ------------------------------------------------------------
G7PAW6_BMF-02      cccgaagggcagtggcaacatcgagcagaggtacagattgcccgaaagcttcagtgcatt
                                                                               

G7PAW6_BMF-01      ---------------------------------caccagcagaaccgaaatcgcgtgtgg
G7PAW6_BMF-02      gcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
                                                    ***************************

G7PAW6_BMF-01      tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggg
G7PAW6_BMF-02      tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggg
                   ************************************************************

G7PAW6_BMF-01      gcgggccctag----
G7PAW6_BMF-02      gcgggccctaggtga
                   ***********    

© 1998-2018