Dataset for CDS BMF of organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G7PAW6_BMF-02      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggg
G7PAW6_BMF-01      atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggg

G7PAW6_BMF-02      gagccggggtcccaacccgggagctctctctctgccgatctgtttgcccagagcctactt
G7PAW6_BMF-01      gagccggggtcccaacccgggagctctctctctgccgatctgtttgcccagagcctactt

G7PAW6_BMF-02      gactgccccctcagccgacttcagctcttccctctcacccactgctgtggccctggcctt
G7PAW6_BMF-01      gactgccccctcagccgacttcagctcttccctctcacccactgctgtggccctggcctt

G7PAW6_BMF-02      cgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
G7PAW6_BMF-01      cgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa

G7PAW6_BMF-02      ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgct
G7PAW6_BMF-01      ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacg--------

G7PAW6_BMF-02      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcggggagcagccc
G7PAW6_BMF-01      ------------------------------------------------------------

G7PAW6_BMF-02      cccgaagggcagtggcaacatcgagcagaggtacagattgcccgaaagcttcagtgcatt
G7PAW6_BMF-01      ------------------------------------------------------------

G7PAW6_BMF-02      gcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
G7PAW6_BMF-01      ---------------------------------caccagcagaaccgaaatcgcgtgtgg

G7PAW6_BMF-02      tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggg
G7PAW6_BMF-01      tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggg

G7PAW6_BMF-02      gcgggccctaggtga
G7PAW6_BMF-01      gcgggccctag----

© 1998-2019