Dataset for CDS BAD of organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5VCD8_BAD-02      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
A0A2K5VCD8_BAD-03      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
A0A2K5VCD8_BAD-01      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
Q2PG01_BAD-01          --------------------------------------------------

A0A2K5VCD8_BAD-02      tgcagagaggggcctgggccccagccccgcgggggacaggccctcagact
A0A2K5VCD8_BAD-03      tgcagagaggggcctgggccccagccccgcgggggacaggccctcagact
A0A2K5VCD8_BAD-01      tgcagagaggggcctgggccccagccccgcgggggacaggccctcagact
Q2PG01_BAD-01          --------------------------------------------------

A0A2K5VCD8_BAD-02      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2K5VCD8_BAD-03      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2K5VCD8_BAD-01      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
Q2PG01_BAD-01          --------------------------------------------------

A0A2K5VCD8_BAD-02      cagcaggagcagccaaccagcagcagccatcatggagggacttcct----
A0A2K5VCD8_BAD-03      cagcaggagcagccaaccagcagcagccatcatggagggagagcttggta
A0A2K5VCD8_BAD-01      cagcaggagcagccaaccagcagcagccatcatgg---------------
Q2PG01_BAD-01          --------------------------------------------------

A0A2K5VCD8_BAD-02      --------------------------------------------------
A0A2K5VCD8_BAD-03      ttctccttcttgggaatctgaggactctgaaaatcccagtgcaaggatgc
A0A2K5VCD8_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------

A0A2K5VCD8_BAD-02      --------------------------------------------------
A0A2K5VCD8_BAD-03      tcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcc
A0A2K5VCD8_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------

A0A2K5VCD8_BAD-02      ---cgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctccag
A0A2K5VCD8_BAD-03      caacacgcagagaatgtaaagctgaaggcgctggggctgtggagacccgg
A0A2K5VCD8_BAD-01      -------------------------aggcgctggggctgtggagacccgg
Q2PG01_BAD-01          --------------------------------------------------

A0A2K5VCD8_BAD-02      ctggacgcgagtcttccagtcctggtgggatcg--------gaacttggg
A0A2K5VCD8_BAD-03      --agtcgccacagctcctaccccgcggggacggaggaggacgaagggatg
A0A2K5VCD8_BAD-01      --agtcgccacagctcctaccccgcggggacggaggaggacgaagggatg
Q2PG01_BAD-01          -----------------------------------------------atg

A0A2K5VCD8_BAD-02      caggggaagctccgcaccctcccagtgacctt--cgctccacgcccggaa
A0A2K5VCD8_BAD-03      gaggaggagcccagc-ccctttcggggccgctcgcgctccgcgccc----
A0A2K5VCD8_BAD-01      gaggaggagcccagc-ccctttcggggccgctcgcgctccgcgccc----
Q2PG01_BAD-01          gaggaggagcccagc-ccctttcggggccgctcgcgctccgcgccc----
                        *** * *** * ** ****  * * * *  *  ****** *****    

A0A2K5VCD8_BAD-02      actccacccgctctcactgtcctggtcggccatcttggatatgggcggaa
A0A2K5VCD8_BAD-03      ------cccaacctc--------------------------tgggcagca
A0A2K5VCD8_BAD-01      ------cccaacctc--------------------------tgggcagca
Q2PG01_BAD-01          ------cccaacctc--------------------------tgggcagca
                             ***   ***                          ***** * *

A0A2K5VCD8_BAD-02      gtgcttccctcaggccttatgcaaaagaggatccgtgctgcctctttcg-
A0A2K5VCD8_BAD-03      cagcgt---tatggccgcgagctccggaggatga----------------
A0A2K5VCD8_BAD-01      cagcgt---tatggccgcgagctccggaggatgagtgacgagtttgtgga
Q2PG01_BAD-01          cagcgt---tatggccgcgagctccggaggatgagtgacgagtttgtgga
                         ** *   *  ****    **    ******                  

A0A2K5VCD8_BAD-02      -------------------------------gtgggagggctgacccaga
A0A2K5VCD8_BAD-03      --------------------------------------------------
A0A2K5VCD8_BAD-01      ctcctttaagggacttcctcgcccgaagagcgcgggcacagcgacgcaga
Q2PG01_BAD-01          ctcctttaaggggcttcctcgcccgaagagcgcgggcacagcgacgcaga

A0A2K5VCD8_BAD-02      ttc------------------------ccttccggtgcatgtga------
A0A2K5VCD8_BAD-03      --------------------------------------------------
A0A2K5VCD8_BAD-01      tgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcgg
Q2PG01_BAD-01          tgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcgg

A0A2K5VCD8_BAD-02      ------------------------------------
A0A2K5VCD8_BAD-03      ------------------------------------
A0A2K5VCD8_BAD-01      aacttgggcaggggaagctccgcaccctcccagtga
Q2PG01_BAD-01          aacttgggcaggggaagctccgcaccctcccagtga

© 1998-2019