Dataset for CDS classical BH3-containing proteins of organism Latimeria chalumnae

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


M3XHJ5_BCL2L11-01      atgccaacagaggaaagtttacaatttgacaaagaccaaggtacatcaga
H3ANP3_BAD-03          atgttcc------agatttcagactccgactcagac--gcgtacg-aaga
H3ANP3_BAD-04          atgttcc------agatttcagactccgactcagac--gcgtacg-aaga
H3ANP3_BAD-02          atgttcc------agatttcagactccgactcagac--gcgtacg-aaga
H3ANP3_BAD-01          atgttcc------agatttcagactccgactcagac--gcgtacg-aaga
                       ***          * * ** * * *  ***  ****    ****   ***

M3XHJ5_BCL2L11-01      tgtaatttctgaatgtggacatttgcatcccaccc---------------
H3ANP3_BAD-03          tgata-----gaacgggccccttgccactgcagtctggaggaggaagagg
H3ANP3_BAD-04          tgata-----gaacgggccccttgccactgcagtctggaggaggaagagg
H3ANP3_BAD-02          tgata-----gaacgggccccttgccactgcagtctggaggaggaagagg
H3ANP3_BAD-01          tgata-----gaacgggccccttgccactgcagtctggaggaggaagagg
                       **  *     *** * *  * **  **   **  *               

M3XHJ5_BCL2L11-01      --aaagaccagatc---------aaccaccgtttgtaaagcaagagggct
H3ANP3_BAD-03          cgagggatcagagccaagtgaaaaaacagcgggtttaaagaaacacagcc
H3ANP3_BAD-04          cgagggatcagagccaagtgaaaaaacagcgggtttaaagaaacacagcc
H3ANP3_BAD-02          cgagggatcagagccaagtgaaaaaacagcgggtttaaagaaacacagcc
H3ANP3_BAD-01          cgagggatcagagccaagtgaaaaaacagcgggtttaaagaaacacagcc
                         *  ** **** *         ** ** **  * ***** ** *  ** 

M3XHJ5_BCL2L11-01      gctactgcattatcagccc---actttcaaaa---gtgatcgcactggtg
H3ANP3_BAD-03          g----------gacagcccccaatctgcagaacccgggacctcacc----
H3ANP3_BAD-04          g----------gacagcccccaatctgcagaacccgggacctcacc----
H3ANP3_BAD-02          g----------gacagcccccaatctgcagaacccgggacctcacc----
H3ANP3_BAD-01          g----------gacagcccccaatctgcagaacccgggacctcacc----
                       *            ******   *  * ** **   * ** * ***     

M3XHJ5_BCL2L11-01      aggtggagagacagatctttactca-------------------------
H3ANP3_BAD-03          ------agagccaccccccttctcacacaggtgtatacggttgggtaaaa
H3ANP3_BAD-04          ------agagccaccccccttctcacacagttttttggggatttac----
H3ANP3_BAD-02          ------agagccaccccccttctcac------------------ac----
H3ANP3_BAD-01          ------agagccaccccccttctcac------------------ac----
                             **** **   *  * ****                         

M3XHJ5_BCL2L11-01      --------gcaccctgatgggaggacttctgttgccccccagcccctgtc
H3ANP3_BAD-03          cttaggaagcgaaataacatggaga-ttctggggcgtccaagttcc----
H3ANP3_BAD-04          -----------agataacatggaga-ttctggggcgtccaagttcc----
H3ANP3_BAD-02          -----------agataacatggaga-ttctggggcgtccaagttcc----
H3ANP3_BAD-01          -----------agataacatggaga-ttctggggcgtccaagttcc----
                                     * *   *  ** *****  **  ** **  **    

M3XHJ5_BCL2L11-01      cttttgtcactaggtccccgtttt-----tcatcttcatgaggcggtcct
H3ANP3_BAD-03          -----------gagtcccagatctcagactcagaatcactggatg-----
H3ANP3_BAD-04          -----------gagtcccagatctcagactcagaatcactggatg-----
H3ANP3_BAD-02          -----------gagtcccagatctcagactcagaatcactggatg-----
H3ANP3_BAD-01          -----------gagtcccagatctcagactcagaatcactggatg-----
                                    ***** * * *     ***   ***   *  *     

M3XHJ5_BCL2L11-01      tagttttatccacatcttccagtggatattttacttttgactctgatata
H3ANP3_BAD-03          -agcttggcc-----ctttcaggacaaggtctcgttccgcacc--accta
H3ANP3_BAD-04          -agcttggcc-----ctttcaggacaaggtctcgttccgcacc--accta
H3ANP3_BAD-02          -agcttggcc-----ctttcaggacaaggtctcgttccgcacc--accta
H3ANP3_BAD-01          -agcttggcc-----ctttcaggacaaggtctcgttccgcacc--accta
                        ** **   *     *** ***   *   * *  **  *   *  *  **

M3XHJ5_BCL2L11-01      gttcatagccctgcacctgtaagtgtccacaag-gctacacagactccaa
H3ANP3_BAD-03          acttctgggc---cgcaaggaagtacgggcaagaactgcggagaat---g
H3ANP3_BAD-04          acttctgggc---cgcaaggaagtacgggcaagaactgcggagaat---g
H3ANP3_BAD-02          acttctgggc---cgcaaggaagtacgggcaagaactgcggagaat---g
H3ANP3_BAD-01          acttctgggc---cgcaaggaagtacgggcaagaactgcggagaat---g
                         *  * * *   * *  * ****     ****  ** *  *** *    

M3XHJ5_BCL2L11-01      gcccatcaagccaactcatcgtacacgtacagcattgcttagcgcaaaga
H3ANP3_BAD-03          agcgatgaattcgacatgtcct----ttctggggcttccgaggccaaaga
H3ANP3_BAD-04          agcgatgaattcgacatgtcct----ttctggggcttccgaggccaaaga
H3ANP3_BAD-02          agcgatgaattcgacatgtcct----ttctggggcttccgaggccaaaga
H3ANP3_BAD-01          agcgatgaattcgacatgtcct----ttctggggcttccgaggccaaaga
                         * ** **  * **   ** *     *   *   * *  **  ******

M3XHJ5_BCL2L11-01      gaac---agcatcccga---------------aactcatggtaagaaccc
H3ANP3_BAD-03          gcgctggagcagctggagaaatggtggacgagagctggtgg-aagaaact
H3ANP3_BAD-04          gcgctggagcagctggagaaatggtggacgagagctggtgg-aagaaact
H3ANP3_BAD-02          gcgctggagcagctggagaaatggtggacgagagctggtgg-aagaaact
H3ANP3_BAD-01          gcgctggagcagctggagaaatggtggacgagagctggtgg-aagaaact
                       *  *   **** *  **               * **  *** ***** * 

M3XHJ5_BCL2L11-01      tttgaactttacataa----------------------------------
H3ANP3_BAD-03          gatacgctctctaaaggggcgcgggcaacccagggacccgcctgggcaa-
H3ANP3_BAD-04          gatacgctctctaaaggggcgcgggcaacccagggacccgcctgggcaa-
H3ANP3_BAD-02          gatacgctctctaaaggggcgcgggcaacccagggacccgcctgggcaac
H3ANP3_BAD-01          gatacgctctctaaaggggcgcgggcaacccagggacccgcctgggcaac
                         *   ** *  * *                                   

M3XHJ5_BCL2L11-01      -----------------------------
H3ANP3_BAD-03          -----------------------------
H3ANP3_BAD-04          -----------------------------
H3ANP3_BAD-02          agggagtgtcgatccgaggacctgactaa
H3ANP3_BAD-01          agggagtgtcgatccgaggacctgactaa
                                                    

© 1998-2018