Dataset for CDS BAD of organism Latimeria chalumnae

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H3ANP3_BAD-03      atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttg
H3ANP3_BAD-04      atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttg
H3ANP3_BAD-02      atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttg
H3ANP3_BAD-01      atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttg
                   ************************************************************

H3ANP3_BAD-03      ccactgcagtctggaggaggaagaggcgagggatcagagccaagtgaaaaaacagcgggt
H3ANP3_BAD-04      ccactgcagtctggaggaggaagaggcgagggatcagagccaagtgaaaaaacagcgggt
H3ANP3_BAD-02      ccactgcagtctggaggaggaagaggcgagggatcagagccaagtgaaaaaacagcgggt
H3ANP3_BAD-01      ccactgcagtctggaggaggaagaggcgagggatcagagccaagtgaaaaaacagcgggt
                   ************************************************************

H3ANP3_BAD-03      ttaaagaaacacagccggacagcccccaatctgcagaacccgggacctcaccagagccac
H3ANP3_BAD-04      ttaaagaaacacagccggacagcccccaatctgcagaacccgggacctcaccagagccac
H3ANP3_BAD-02      ttaaagaaacacagccggacagcccccaatctgcagaacccgggacctcaccagagccac
H3ANP3_BAD-01      ttaaagaaacacagccggacagcccccaatctgcagaacccgggacctcaccagagccac
                   ************************************************************

H3ANP3_BAD-03      cccccttctcacacaggtgtatacggttgggtaaaacttaggaagcgaaataacatggag
H3ANP3_BAD-04      cccccttctcacacagttttttggggatttac---------------agataacatggag
H3ANP3_BAD-02      cccccttctcac------------------ac---------------agataacatggag
H3ANP3_BAD-01      cccccttctcac------------------ac---------------agataacatggag
                   ************                                   * ***********

H3ANP3_BAD-03      attctggggcgtccaagttccgagtcccagatctcagactcagaatcactggatgagctt
H3ANP3_BAD-04      attctggggcgtccaagttccgagtcccagatctcagactcagaatcactggatgagctt
H3ANP3_BAD-02      attctggggcgtccaagttccgagtcccagatctcagactcagaatcactggatgagctt
H3ANP3_BAD-01      attctggggcgtccaagttccgagtcccagatctcagactcagaatcactggatgagctt
                   ************************************************************

H3ANP3_BAD-03      ggccctttcaggacaaggtctcgttccgcaccacctaacttctgggccgcaaggaagtac
H3ANP3_BAD-04      ggccctttcaggacaaggtctcgttccgcaccacctaacttctgggccgcaaggaagtac
H3ANP3_BAD-02      ggccctttcaggacaaggtctcgttccgcaccacctaacttctgggccgcaaggaagtac
H3ANP3_BAD-01      ggccctttcaggacaaggtctcgttccgcaccacctaacttctgggccgcaaggaagtac
                   ************************************************************

H3ANP3_BAD-03      gggcaagaactgcggagaatgagcgatgaattcgacatgtcctttctggggcttccgagg
H3ANP3_BAD-04      gggcaagaactgcggagaatgagcgatgaattcgacatgtcctttctggggcttccgagg
H3ANP3_BAD-02      gggcaagaactgcggagaatgagcgatgaattcgacatgtcctttctggggcttccgagg
H3ANP3_BAD-01      gggcaagaactgcggagaatgagcgatgaattcgacatgtcctttctggggcttccgagg
                   ************************************************************

H3ANP3_BAD-03      ccaaagagcgctggagcagctggagaaatggtggacgagagctggtggaagaaactgata
H3ANP3_BAD-04      ccaaagagcgctggagcagctggagaaatggtggacgagagctggtggaagaaactgata
H3ANP3_BAD-02      ccaaagagcgctggagcagctggagaaatggtggacgagagctggtggaagaaactgata
H3ANP3_BAD-01      ccaaagagcgctggagcagctggagaaatggtggacgagagctggtggaagaaactgata
                   ************************************************************

H3ANP3_BAD-03      cgctctctaaaggggcgcgggcaacccagggacccgcctgggcaa---------------
H3ANP3_BAD-04      cgctctctaaaggggcgcgggcaacccagggacccgcctgggcaa---------------
H3ANP3_BAD-02      cgctctctaaaggggcgcgggcaacccagggacccgcctgggcaacagggagtgtcgatc
H3ANP3_BAD-01      cgctctctaaaggggcgcgggcaacccagggacccgcctgggcaacagggagtgtcgatc
                   *********************************************               

H3ANP3_BAD-03      ---------------
H3ANP3_BAD-04      ---------------
H3ANP3_BAD-02      cgaggacctgactaa
H3ANP3_BAD-01      cgaggacctgactaa
                                  

© 1998-2018