Dataset for CDS classical BH3-containing proteins of organism Labrus bergylta

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3MLA0_BAD-03       atgaagtgtaacaacaagtgttatcattttataagacttgtttttgtcaa
A0A3Q3MLA0_BAD-02       --------------------------------------------------
A0A3Q3MLA0_BAD-01       atgacac-taacagcaagt-------------------------------
A0A3Q3ESW6_BCL2L11      atgcaccgtccgtccagac-------------------------------
A0A3Q3GUU5_BMF-01       atggacgat-----------------------------------------
                                                                          

A0A3Q3MLA0_BAD-03       aaagcagtcggttatctgcgcaggttacggcactgtgaatacctttggac
A0A3Q3MLA0_BAD-02       --------------------------------------------------
A0A3Q3MLA0_BAD-01       --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q3GUU5_BMF-01       --------------------------------------------------
                                                                          

A0A3Q3MLA0_BAD-03       cggcttacagcagggacagcacagagaataagatatcctgcttgggtgtg
A0A3Q3MLA0_BAD-02       --------------------------------------------------
A0A3Q3MLA0_BAD-01       --------------------------------------------------
A0A3Q3ESW6_BCL2L11      ---------------------caccgaaccggttggatggctcgcccaca
A0A3Q3GUU5_BMF-01       -------------------------gaagaggatgatgtgttcgagc---
                                                                          

A0A3Q3MLA0_BAD-03       tt--agatgtcacgatggctgcgaagttcactatttcagacagtgagtcc
A0A3Q3MLA0_BAD-02       --------------atggctgcgaagttcactatttcagacagtgagtcc
A0A3Q3MLA0_BAD-01       -----gatgtcacgatggctgcgaagttcactatttcagacagtgagtcc
A0A3Q3ESW6_BCL2L11      gtaacggaatcacacgggaccagaggagatccaccacaaacctcccgttc
A0A3Q3GUU5_BMF-01       ----cggacccacacag-------------ctggcgca---cctattttc
                                        *             *     **         * *

A0A3Q3MLA0_BAD-03       gggtcagaagaggaggtaa-----------------------aagaggaa
A0A3Q3MLA0_BAD-02       gggtcagaagaggaggtaa-----------------------aagaggaa
A0A3Q3MLA0_BAD-01       gggtcagaagaggaggtaa-----------------------aagaggaa
A0A3Q3ESW6_BCL2L11      agacaacagcggggggcgaaactttggccgcaccgattccacgggaggag
A0A3Q3GUU5_BMF-01       aggagataaagtgtgaaga-------------------ccggggcacgca
                         *   * *    * *   *                          * *  

A0A3Q3MLA0_BAD-03       gagaac------------------gaccaatca--------tcagctgtg
A0A3Q3MLA0_BAD-02       gagaac------------------gaccaatca--------tcagctgtg
A0A3Q3MLA0_BAD-01       gagaac------------------gaccaatca--------tcagctgtg
A0A3Q3ESW6_BCL2L11      gagagccggactcaccgtcccggtgcagattcaaaccagtctcccctgtg
A0A3Q3GUU5_BMF-01       gacacctgg---cccggccctggcacccaacaacggcatgctgccctgtg
                        ** * *                      *   *        *   *****

A0A3Q3MLA0_BAD-03       ga--------------------agagccgcatg-----------------
A0A3Q3MLA0_BAD-02       ga--------------------agagccgcatg-----------------
A0A3Q3MLA0_BAD-01       ga--------------------agagccgcatg-----------------
A0A3Q3ESW6_BCL2L11      gacagcctcggcgtgttccagaagagatctatatttcaccttcctcgccg
A0A3Q3GUU5_BMF-01       ga------------gtcgcagaggagccc---------------------
                        **                     ***                        

A0A3Q3MLA0_BAD-03       ----------------ttccccaacgacacagctta-----------acc
A0A3Q3MLA0_BAD-02       ----------------ttccccaacgacacagctta-----------acc
A0A3Q3MLA0_BAD-01       ----------------ttccccaacgacacagctta-----------acc
A0A3Q3ESW6_BCL2L11      cgcctcgagtggatacttctcctacgacggagactcgctgccgagc-tct
A0A3Q3GUU5_BMF-01       -------agaccactcttctacggcaacgcaggttttcgattacacttcc
                                        ***  *  * **  **  *             * 

A0A3Q3MLA0_BAD-03       ctaccagagctcagactggcagggactggtcggatcaggttga-------
A0A3Q3MLA0_BAD-02       ctaccagagctcagactggcagggactggtcggatcaggttga-------
A0A3Q3MLA0_BAD-01       ctaccagagctcagactggcagggactggtcggatcaggttga-------
A0A3Q3ESW6_BCL2L11      ccgctctccccgaggccgctgacggctgacaaagccacgcagactcccag
A0A3Q3GUU5_BMF-01       ctgcaaactttgagcttgttgggg---------atcaggaaga-------
                        *  *        **   *     *           ** *  **       

A0A3Q3MLA0_BAD-03       actcagagtcccacgcttacaccgtctccagggacgaagagctccaggcc
A0A3Q3MLA0_BAD-02       actcagagtcccacgcttacaccgtctccagggacgaagagctccaggcc
A0A3Q3MLA0_BAD-01       actcagagtcccacgcttacaccgtctccagggacgaagagctccaggcc
A0A3Q3ESW6_BCL2L11      ccccagtggccaggtgatgcaacacgctctgcagcgcatgactgaggcgc
A0A3Q3GUU5_BMF-01       ---gagcggacaag------aaagcgagctgcagcaaat-----------
                            ** *  *         *       * *   *  *            

A0A3Q3MLA0_BAD-03       aggggggaagaagaggctggcacccccacggaaggagcgccattcagggg
A0A3Q3MLA0_BAD-02       aggggggaagaagaggctggcacccccacggaaggagcgccattcagggg
A0A3Q3MLA0_BAD-01       aggggggaagaagaggctggcacccccacggaaggagcgccattcagggg
A0A3Q3ESW6_BCL2L11      acggaggaggaccgg--------------ggacgcagcagcagtacgggc
A0A3Q3GUU5_BMF-01       -------------tg--------------ggatggagcagcagca-----
                                      *              *** * ***  **        

A0A3Q3MLA0_BAD-03       acgatcaaa-----atcggctccccctgcc--------------------
A0A3Q3MLA0_BAD-02       acgatcaaa-----atcggctccccctgcc--------------------
A0A3Q3MLA0_BAD-01       acgatcaaa-----atcggctccccctgcc--------------------
A0A3Q3ESW6_BCL2L11      actctcccagcctcactagccggcgacaacggactgcagcaggggacatg
A0A3Q3GUU5_BMF-01       --------------acctgttgcccacagt--------------------
                                      *   *    *                          

A0A3Q3MLA0_BAD-03       ---ttgtgggcagctaaaaaatacggccggcagctccggaggatgagcga
A0A3Q3MLA0_BAD-02       ---ttgtgggcagctaaaaaatacggccggcagctccggaggatgagcga
A0A3Q3MLA0_BAD-01       ---ttgtgggcagctaaaaaatacggccggcagctccggaggatgagcga
A0A3Q3ESW6_BCL2L11      caggcggaggc---ta------ttggacgagatctccaacgcattggcga
A0A3Q3GUU5_BMF-01       ---gtggaggccagca------tcggtctgaaactccaactcataggaga
                             *  ***    *        ** *   * ****     **  * **

A0A3Q3MLA0_BAD-03       cgagtttgacatcctgcttgacaaaggggagatgaaaaaagtaaga----
A0A3Q3MLA0_BAD-02       cgagtttgacatcctgcttgacaaaggggtgagaattaaagggggggggg
A0A3Q3MLA0_BAD-01       cgagtttgacatcctgcttgacaaaggggtgagaattaaagggggggggg
A0A3Q3ESW6_BCL2L11      cgactataatagactactgctatggagaatggcaggtagacatggtcg--
A0A3Q3GUU5_BMF-01       ccagtttcatcgg----------gaacacttacaactgta----------
                        * * * * *                              *          

A0A3Q3MLA0_BAD-03       --------------agccctgggccagccaaacagatg--caccactc--
A0A3Q3MLA0_BAD-02       ggggtagcaggggtggctgtggattagtggtggagtcggtcgtctctcaa
A0A3Q3MLA0_BAD-01       ggggtagcaggggtggctgtggattagtggtggagtcggtcgtctctcaa
A0A3Q3ESW6_BCL2L11      --------------gcctgaggtccatccaaacccgcagccgcacatcca
A0A3Q3GUU5_BMF-01       -----------------------tcatcgaaaccaaagg----------a
                                                 *                        

A0A3Q3MLA0_BAD-03       ---------ca-------agagttggtggagctacctcttcagcca----
A0A3Q3MLA0_BAD-02       ccgaaaagtca-------ggagttcaatacccagctcctgcagccacatg
A0A3Q3MLA0_BAD-01       ccgaaaagtca-------ggagttcaatacccagctcctgcagccacatg
A0A3Q3ESW6_BCL2L11      accggagcccaccatgctg----ctgtgtacgggtctcatgatccttctg
A0A3Q3GUU5_BMF-01       accaggggcctctgtggtggcgtctgggtgcagctttgctgagccttctg
                                 *                               * **     

A0A3Q3MLA0_BAD-03       -------------------ccaggagacagagggagagaacaacc--acc
A0A3Q3MLA0_BAD-02       tccgatgtgtccttgggtccttgaatgtgtataaatgggattacctaata
A0A3Q3MLA0_BAD-01       tccgatgtgtccttgggtccttgaatgtgtataaatgggattacctaata
A0A3Q3ESW6_BCL2L11      attggatggattatctacttgcgaggcaatacaaacagccatgac-----
A0A3Q3GUU5_BMF-01       tttgacaggggcttc-atcgctggagcaggacgg----------------
                                              *       *                   

A0A3Q3MLA0_BAD-03       acgaaaaccacacc-caccgcaatgagtaa
A0A3Q3MLA0_BAD-02       ctgatcatcactttacacagcagcctctag
A0A3Q3MLA0_BAD-01       ctgatcatcactttacacagcagcctctag
A0A3Q3ESW6_BCL2L11      ---------------cactctcaggtgtag
A0A3Q3GUU5_BMF-01       ----------------------aggtga--
                                                      

© 1998-2019