Dataset for CDS BMF of organism Ictidomys tridecemlineatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


I3MDS9_BMF-01      atgccccgagcgggcgtattttggaaacaataccgcgcggtgcgcagtggcctcctccgg
I3MDS9_BMF-02      -----------------gtttt--------------------------------------
                                     ****                                      

I3MDS9_BMF-01      cgcccgccagagtccgcagccgccgccggccctgccagcggctcccgcctccctgggagc
I3MDS9_BMF-02      ------------------------------------------------------------
                                                                               

I3MDS9_BMF-01      ggagtctcgctcccccaagtgttcatcacgctggaccctggcgcagagccctggcatcac
I3MDS9_BMF-02      ------------------------------------------------------------
                                                                               

I3MDS9_BMF-01      gactcggaggccgagactctctcctggagtcacccaggtgagatggagccgcctcagtgt
I3MDS9_BMF-02      --------------------------------cccagaggagatggagccgcctcagtgt
                                                   *****  *********************

I3MDS9_BMF-01      gtggaggagctggaagatgatgtgttccagccagaggatggggagccagggacccagcct
I3MDS9_BMF-02      gtggaggagctggaagatgatgtgttccagccagaggatggggagccagggacccagcct
                   ************************************************************

I3MDS9_BMF-01      gggagcttgctctctgctgacttgtttgcccagagccagctggactgccccctcagcagg
I3MDS9_BMF-02      gggagcttgctctctgctgacttgtttgcccagagccagctggactgccccctcagcagg
                   ************************************************************

I3MDS9_BMF-01      cttcagctcttccctctcacccactgctgtggtcctgggcttcgacctaccagccaggaa
I3MDS9_BMF-02      cttcagctcttccctctcacccactgctgtggtcctgggcttcgacctaccagccaggaa
                   ************************************************************

I3MDS9_BMF-01      gacaaggccactcagaccctcagcccagcctccccaagccagggtgtcatgctgccttgt
I3MDS9_BMF-02      gacaaggccactcagaccctcagcccagcctccccaagccagggtgtcatgctgccttgt
                   ************************************************************

I3MDS9_BMF-01      ggagtgactgaagaaccccagcgactcttttatggcaatgctggctaccggcttcctctc
I3MDS9_BMF-02      ggagtgactgaagaaccccagcgactcttttatggcaatgctggctaccggcttcctctc
                   ************************************************************

I3MDS9_BMF-01      cctgctagtttccctgcaggcttgccccttggagagcagccccctgaaggtcagtggcaa
I3MDS9_BMF-02      cctgctagtttccctgcaggcttgccccttggagagcagccccctgaaggtcagtggcaa
                   ************************************************************

I3MDS9_BMF-01      catcgagcagaggtacagatcgcccgaaaacttcagtgcattgcagaccagttccaccgg
I3MDS9_BMF-02      catcgagcagaggtacagatcgcccgaaaacttcagtgcattgcagaccagttccaccgg
                   ************************************************************

I3MDS9_BMF-01      cttcatatgcagcaacaccagcagaaccgaaatcgtgtgtggtggcagattctcctcttc
I3MDS9_BMF-02      cttcatatgcagcaacaccagcagaaccgaaatcgtgtgtggtggcagattctcctcttc
                   ************************************************************

I3MDS9_BMF-01      ctgcacaacctggcattaaatggagatgagaacagggaccgggcaggtcctaggtga
I3MDS9_BMF-02      ctgcacaacctggcattaaatggagatgagaacagggaccgggcaggtcctaggtga
                   *********************************************************

© 1998-2019