Dataset for CDS BCL2L11 of organism Ictidomys tridecemlineatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A287DFJ0_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A287DFJ0_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
                        **************************************************

A0A287DFJ0_BCL2L11      acaattgcagcctgcagagaggcctccccagctcaggccgggggccccta
A0A287DFJ0_BCL2L11      acaattgcagcctgcagagaggcctccccagctcaggccgggggccccta
                        **************************************************

A0A287DFJ0_BCL2L11      cctcccttcagacagagcctcaaggtaatcccgaaggcgaaggggaccgc
A0A287DFJ0_BCL2L11      cctcccttcagacagagcctca----------------------------
                        **********************                            

A0A287DFJ0_BCL2L11      tgcccccacggcagcccacagggcccgctggccccaccggccagccctgg
A0A287DFJ0_BCL2L11      --------------------------------------------------
                                                                          

A0A287DFJ0_BCL2L11      cccttttgctaccagatccccgcttttcatctttgtgagaagatcttccc
A0A287DFJ0_BCL2L11      --------------------------------------------------
                                                                          

A0A287DFJ0_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A287DFJ0_BCL2L11      ----------------------------------------agacaggagc
                                                                **********

A0A287DFJ0_BCL2L11      ccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A287DFJ0_BCL2L11      ccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
                        **************************************************

A0A287DFJ0_BCL2L11      ccaggccttcaaccattatctgagtgcaatggcttccatgcgggagtctc
A0A287DFJ0_BCL2L11      ccaggccttcaaccattatctgagtgcaatggcttccatgcgggagtctc
                        **************************************************

A0A287DFJ0_BCL2L11      aggcagaacctgcagacatgcgcccggagatctggatcgcgcaggagctg
A0A287DFJ0_BCL2L11      aggcagaacctgcagacatgcgcccggagatctggatcgcgcaggagctg
                        **************************************************

A0A287DFJ0_BCL2L11      cggcgaatcggagatgagtttaacctgtattacccacggagggtattttt
A0A287DFJ0_BCL2L11      cggcgaatcggagatgagtttaacctgtattacccacggagggtattttt
                        **************************************************

A0A287DFJ0_BCL2L11      taataattaccaacctgaagaccgcccccaaatggttatcttgcgcctgt
A0A287DFJ0_BCL2L11      taataattaccaacctgaagaccgcccccaaatggttatcttgcgcctgt
                        **************************************************

A0A287DFJ0_BCL2L11      tgcgttgcatcatccgcctggtgtggaggatgcactga
A0A287DFJ0_BCL2L11      tgcgttgcatcatccgcctggtgtggaggatgcactga
                        **************************************

© 1998-2018