Dataset for CDS BAD of organism Ictidomys tridecemlineatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

I3MBM5_BAD-01      atggggatcccagaaaaagccctcatcgcttccacgcacgctccaggcgcgaggaagtca
I3MBM5_BAD-02      atggggatcccagaaaaagccctcatcgcttccacgcacgctccaggcgcgaggaagtca

I3MBM5_BAD-01      gggaaggagggaccggggaggaaggcggtaggacccgcaggtcggcggcgagggtggcac
I3MBM5_BAD-02      gggaaggagggaccggggaggaaggcggtaggacccgcaggtcggcggcgagggtggcac

I3MBM5_BAD-01      ccggcctggacccagagcatgttccagatcccagagtttgagcccagtgagcaggaagac
I3MBM5_BAD-02      ccggcctggacccagagcatgttccagatcccagagtttgagcccagtgagcaggaagac

I3MBM5_BAD-01      tccagctccgcagaagggggcctgggccccagccccgcaggggaccggccaggctgcggc
I3MBM5_BAD-02      tccagctccgcagaagggggcctgggccccagccccgcaggggaccggccaggctgcggc

I3MBM5_BAD-01      ttggctccaggcctccccagggacacgggtcaccagcagtggcaggcaaccagcagcagc
I3MBM5_BAD-02      ttggctccaggcctccccagggacacgggtcaccagcagtggcaggcaaccagcagcagc

I3MBM5_BAD-01      aaccatggaggcgctggggctacggagacccggagtcgccacagctcgtaccccgcagat
I3MBM5_BAD-02      aaccatggaggcgctggggctacggagacccggagtcgccacagctcgtaccccgcagat

I3MBM5_BAD-01      accgatttggatgaagggatggaagaggagcccagccccttccgcggccgctcgcgctcg
I3MBM5_BAD-02      accgatttggatgaagggatggaagaggagcccagccccttccgcggccgctcgcgctcg

I3MBM5_BAD-01      gcgccccccaatctctgggctgcacagcgctacggccgcgagctccggaggatgagcgac
I3MBM5_BAD-02      gcgccccccaatctctgggctgcacagcgctacggccgcgagctccggaggatgagcgac

I3MBM5_BAD-01      gaattcgagggctcctttaagg-gacttcctcgcccgaggagcgcaggcacagcgtcgca
I3MBM5_BAD-02      gaattcgagggctcctttaaggtgacattttc----------------------------
                   ********************** *** *  **                            

I3MBM5_BAD-01      gatgcggcaaagctccagctggacgcgcttcatccagtcctggtgggatcggaacttggg
I3MBM5_BAD-02      --------------ccagtc------------cccattcctgaggg--------------
                                 ****               *** *****  **              

I3MBM5_BAD-01      gaggcgaggctccgccccctcccagtga
I3MBM5_BAD-02      --------------------cctaa---
                                       ** *    

© 1998-2019