Dataset for CDS classical BH3-containing proteins of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

44 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q13794_PMAIP1-01       atgc----------------------------------------------
Q13794_PMAIP1-02       atgc----------------------------------------------
Q13323_BIK-01          atgt----------------------------------------------
Q92934_BAD-03          atgt----------------------------------------------
Q92934_BAD-04          atgt----------------------------------------------
Q92934_BAD-02          atgt----------------------------------------------
Q92934_BAD-01          atgt----------------------------------------------
B4DZQ9_BAD-01          atgt----------------------------------------------
O00198_HRK-01          atgt----------------------------------------------
Q9BXH1_BBC3-04         atgaaatttg----------------------------------------
Q9BXH1_BBC3-05         atgaaatttg----------------------------------------
Q9BXH1_BBC3-03         atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccag
B4DQK3_BBC3-01         --------------------------------------------------
Q9BXH1_BBC3-06         --------------------------------------------------
Q96LC9_BMF-05          atgg----------------------------------------------
Q96LC9_BMF-07          atgg----------------------------------------------
Q96LC9_BMF-04          atgg----------------------------------------------
Q96LC9_BMF-03          atgg----------------------------------------------
Q96LC9_BMF-02          atgg----------------------------------------------
Q96LC9_BMF-01          atgg----------------------------------------------
Q96LC9_BMF-06          atgg----------------------------------------------
O43521_BCL2L11-11      atgg----------------------------------------------
O43521_BCL2L11-06      atgg----------------------------------------------
O43521_BCL2L11-15      atgg----------------------------------------------
O43521_BCL2L11-23      atgg----------------------------------------------
O43521_BCL2L11-13      atgg----------------------------------------------
O43521_BCL2L11-17      atgg----------------------------------------------
Q6JTU4_BCL2L11-01      atg-----------------------------------------------
O43521_BCL2L11-22      atgg----------------------------------------------
O43521_BCL2L11-08      atgg----------------------------------------------
O43521_BCL2L11-07      atgg----------------------------------------------
O43521_BCL2L11-19      atgg----------------------------------------------
O43521_BCL2L11-21      atgg----------------------------------------------
O43521_BCL2L11-02      atgg----------------------------------------------
O43521_BCL2L11-03      atgg----------------------------------------------
O43521_BCL2L11-24      atgg----------------------------------------------
O43521_BCL2L11-12      atgg----------------------------------------------
O43521_BCL2L11-05      atgg----------------------------------------------
O43521_BCL2L11-25      atgg----------------------------------------------
O43521_BCL2L11-18      atgg----------------------------------------------
O43521_BCL2L11-09      atgg----------------------------------------------
O43521_BCL2L11-16      atgg----------------------------------------------
O43521_BCL2L11-10      atgg----------------------------------------------
O43521_BCL2L11-20      atgg----------------------------------------------

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       --------------------------------------------------
Q13323_BIK-01          --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
O00198_HRK-01          --------------------------------------------------
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         --------------------------------------------------
Q9BXH1_BBC3-03         ggctgcttccacgacgtgggtcccctgccagatttgtggccccagggagc
B4DQK3_BBC3-01         -----------------------------------atggccccagggagc
Q9BXH1_BBC3-06         --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
O43521_BCL2L11-11      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-13      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      --------------------------------------------------
O43521_BCL2L11-08      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-02      --------------------------------------------------
O43521_BCL2L11-03      --------------------------------------------------
O43521_BCL2L11-24      --------------------------------------------------
O43521_BCL2L11-12      --------------------------------------------------
O43521_BCL2L11-05      --------------------------------------------------
O43521_BCL2L11-25      --------------------------------------------------
O43521_BCL2L11-18      --------------------------------------------------
O43521_BCL2L11-09      --------------------------------------------------
O43521_BCL2L11-16      --------------------------------------------------
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       --------------------------------------------------
Q13323_BIK-01          -------------------------------------ctgaagtaagacc
Q92934_BAD-03          --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
O00198_HRK-01          --------------------------------------------------
Q9BXH1_BBC3-04         ------------------------------------------gcatgggg
Q9BXH1_BBC3-05         ------------------------------------------gcatgggg
Q9BXH1_BBC3-03         gccatggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
B4DQK3_BBC3-01         gccatggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
Q9BXH1_BBC3-06         ---atggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
O43521_BCL2L11-11      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-13      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      --------------------------------------------------
O43521_BCL2L11-08      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-02      --------------------------------------------------
O43521_BCL2L11-03      --------------------------------------------------
O43521_BCL2L11-24      --------------------------------------------------
O43521_BCL2L11-12      --------------------------------------------------
O43521_BCL2L11-05      --------------------------------------------------
O43521_BCL2L11-25      --------------------------------------------------
O43521_BCL2L11-18      --------------------------------------------------
O43521_BCL2L11-09      --------------------------------------------------
O43521_BCL2L11-16      --------------------------------------------------
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       --------------------------------------------------
Q13323_BIK-01          cctctccagagacatcttgat--------------------ggagaccct
Q92934_BAD-03          --------------tccagatcc-----------------cagagtttga
Q92934_BAD-04          --------------tccagatcc-----------------cagagtttga
Q92934_BAD-02          --------------tccagatcc-----------------cagagtttga
Q92934_BAD-01          --------------tccagatcc-----------------cagagtttga
B4DZQ9_BAD-01          --------------tccagatcc-----------------cagagtttga
O00198_HRK-01          --------------gcccgtgcc-----------------c----cctgc
Q9BXH1_BBC3-04         tctgcccaggcatgtcc---------------------------------
Q9BXH1_BBC3-05         tctgcccaggcatgtcc---------------------------------
Q9BXH1_BBC3-03         cctggcccgcgacggcccgcgcc-----------------c----cttcc
B4DQK3_BBC3-01         cctggcccgcgacggcccgcgcc-----------------c----cttcc
Q9BXH1_BBC3-06         cctggcccgcgacggcccgcgcc-----------------c----cttcc
Q96LC9_BMF-05          -------agccatctcagtgtgtggaggagctggaggatgatgtgttcca
Q96LC9_BMF-07          -------agccatctcagtgtgtggaggagctggaggatgatgtgttcca
Q96LC9_BMF-04          -------agccatctcagtgtgtggaggagctggaggatgatgtgttcca
Q96LC9_BMF-03          -------agccatctcagtgtgtggaggagctggaggatgatgtgttcca
Q96LC9_BMF-02          -------agccatctcagtgtgtggaggagctggaggatgatgtgttcca
Q96LC9_BMF-01          -------agccatctcagtgtgtggaggagctggaggatgatgtgttcca
Q96LC9_BMF-06          -------agccatctcagtgtgtggaggagctggaggatgatgtgttcca
O43521_BCL2L11-11      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-06      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-15      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-23      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-13      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-17      ----caaagcaaccttctgatgt------------aagttctgagtgtga
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-08      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-07      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-19      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-21      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-02      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-03      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-24      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-12      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-05      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-25      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-18      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-09      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-16      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-10      ----caaagcaaccttctgatgt------------aagttctgagtgtga
O43521_BCL2L11-20      ----caaagcaaccttctgatgt------------aagttctgagtgtga

Q13794_PMAIP1-01       -ctgggaagaagg-------------------------------------
Q13794_PMAIP1-02       -ctgggaagaagg-------------------------------------
Q13323_BIK-01          cctgtatgagcagctcctggaacccccgacc-------------------
Q92934_BAD-03          gccgagtgagcag-----gaagactccagct-------------------
Q92934_BAD-04          gccgagtgagcag-----gaagactccagct-------------------
Q92934_BAD-02          gccgagtgagcag-----gaagactccagct-------------------
Q92934_BAD-01          gccgagtgagcag-----gaagactccagct-------------------
B4DZQ9_BAD-01          gccgagtgagcag-----gaagactccagct-------------------
O00198_HRK-01          accgcggccgc--------ggccccccggcc-------------------
Q9BXH1_BBC3-04         -------atgcca-----ggtgcccagg----------------------
Q9BXH1_BBC3-05         -------atgcca-----ggtgcccagg----------------------
Q9BXH1_BBC3-03         cgctcggccgcct-----ggtgccctcggca-------------------
B4DQK3_BBC3-01         cgctcggccgcct-----ggtgccctcggca-------------------
Q9BXH1_BBC3-06         cgctcggccgcct-----ggtgccctcggca-------------------
Q96LC9_BMF-05          accagaggatggggagccggtgacccaacccgggagcttgctctctgctg
Q96LC9_BMF-07          accagaggatggggagccggtgacccaacccgggagcttgctctctgctg
Q96LC9_BMF-04          accagaggatggggagccggtgacccaacccgggagcttgctctctgctg
Q96LC9_BMF-03          accagaggatggggagccggtgacccaacccgggagcttgctctctgctg
Q96LC9_BMF-02          accagaggatggggagccggtgacccaacccgggagcttgctctctgctg
Q96LC9_BMF-01          accagaggatggggagccggtgacccaacccgggagcttgctctctgctg
Q96LC9_BMF-06          accagaggatggggagccggtgacccaacccgggagcttgctctctgctg
O43521_BCL2L11-11      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-06      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-15      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-23      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-13      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-17      ccgagaaggtagacaa----------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-08      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-07      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-19      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-21      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-02      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-03      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-24      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-12      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-05      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-25      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-18      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-09      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-16      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-10      ccgagaaggtagacaa----------------------------------
O43521_BCL2L11-20      ccgagaaggtagacaa----------------------------------

Q13794_PMAIP1-01       --------------------cgcgcaagaacgctc---------------
Q13794_PMAIP1-02       --------------------cgcgcaagaacgctc---------------
Q13323_BIK-01          ------atg----gaggttcttggcatgactgactctgaagagg------
Q92934_BAD-03          -----------------ctgcagagaggg--gcct-------gg------
Q92934_BAD-04          -----------------ctgcagagaggg--gcct-------gg------
Q92934_BAD-02          -----------------ctgcagagaggg--gcct-------gg------
Q92934_BAD-01          -----------------ctgcagagaggg--gcct-------gg------
B4DZQ9_BAD-01          -----------------ctgcagagaggg--gcct-------gg------
O00198_HRK-01          ------gtgt---gcgcctgcagcgcgggtcgcct-------gg------
Q9BXH1_BBC3-04         -------------gctgcttccacga------------------------
Q9BXH1_BBC3-05         -------------gctgcttccacga------------------------
Q9BXH1_BBC3-03         ------gtgtcctgcggcctctgcgagcccggcct-------ggctgccg
B4DQK3_BBC3-01         ------gtgtcctgcggcctctgcgagcccggcct-------ggctgccg
Q9BXH1_BBC3-06         ------gtgtcctgcggcctctgcgagcccggcct-------ggctgccg
Q96LC9_BMF-05          acctgtttgcccagagcctactggactgccccctc---------------
Q96LC9_BMF-07          acctgtttgcccagagcctactggactgccccctc---------------
Q96LC9_BMF-04          acctgtttgcccagagcctactggactgccccctc---------------
Q96LC9_BMF-03          acctgtttgcccagagcctactggactgccccctc---------------
Q96LC9_BMF-02          acctgtttgcccagagcctactggactgccccctc---------------
Q96LC9_BMF-01          acctgtttgcccagagcctactggactgccccctc---------------
Q96LC9_BMF-06          acctgtttgcccagagcctactggactgccccctc---------------
O43521_BCL2L11-11      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-06      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-15      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-23      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-13      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-17      ------ttgc----agcctgcggagaggcctcccc---------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-08      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-07      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-19      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-21      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-02      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-03      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-24      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-12      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-05      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-25      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-18      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-09      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-16      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-10      ------ttgc----agcctgcggagaggcctcccc---------------
O43521_BCL2L11-20      ------ttgc----agcctgcggagaggcctcccc---------------

Q13794_PMAIP1-01       ---------------------------------aac-----cgagcc---
Q13794_PMAIP1-02       ---------------------------------aac-----cgagcc---
Q13323_BIK-01          ---------------------------------acc-----tggacc---
Q92934_BAD-03          ---------------------------------gcc-----ccagcc---
Q92934_BAD-04          ---------------------------------gcc-----ccagcc---
Q92934_BAD-02          ---------------------------------gcc-----ccagcc---
Q92934_BAD-01          ---------------------------------gcc-----ccagcc---
B4DZQ9_BAD-01          ---------------------------------gcc-----ccagcc---
O00198_HRK-01          ---------------------------------ggc-----tgcgct---
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         --------------------------------------------------
Q9BXH1_BBC3-03         cccccgccgcccccaccctgctgcccgctgcctacc-----tctgcg---
B4DQK3_BBC3-01         cccccgccgcccccaccctgctgcccgctgcctacc-----tctgcg---
Q9BXH1_BBC3-06         cccccgccgcccccaccctgctgcccgctgcctacc-----tctgcg---
Q96LC9_BMF-05          ---------------------------------agccgacttcagctctt
Q96LC9_BMF-07          ---------------------------------agccgacttcagctctt
Q96LC9_BMF-04          ---------------------------------agccgacttcagctctt
Q96LC9_BMF-03          ---------------------------------agccgacttcagctctt
Q96LC9_BMF-02          ---------------------------------agccgacttcagctctt
Q96LC9_BMF-01          ---------------------------------agccgacttcagctctt
Q96LC9_BMF-06          ---------------------------------agccgacttcagctctt
O43521_BCL2L11-11      ---------------------------------agc-----tcagac---
O43521_BCL2L11-06      ---------------------------------agc-----tcagac---
O43521_BCL2L11-15      ---------------------------------agc-----tcagac---
O43521_BCL2L11-23      ---------------------------------agc-----tcagac---
O43521_BCL2L11-13      ---------------------------------agc-----tcagac---
O43521_BCL2L11-17      ---------------------------------agc-----tcagac---
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      ---------------------------------agc-----tcagac---
O43521_BCL2L11-08      ---------------------------------agc-----tcagac---
O43521_BCL2L11-07      ---------------------------------agc-----tcagac---
O43521_BCL2L11-19      ---------------------------------agc-----tcagac---
O43521_BCL2L11-21      ---------------------------------agc-----tcagac---
O43521_BCL2L11-02      ---------------------------------agc-----tcagac---
O43521_BCL2L11-03      ---------------------------------agc-----tcagac---
O43521_BCL2L11-24      ---------------------------------agc-----tcagac---
O43521_BCL2L11-12      ---------------------------------agc-----tcagac---
O43521_BCL2L11-05      ---------------------------------agc-----tcagac---
O43521_BCL2L11-25      ---------------------------------agc-----tcagac---
O43521_BCL2L11-18      ---------------------------------agc-----tcagac---
O43521_BCL2L11-09      ---------------------------------agc-----tcagac---
O43521_BCL2L11-16      ---------------------------------agc-----tcagac---
O43521_BCL2L11-10      ---------------------------------agc-----tcagac---
O43521_BCL2L11-20      ---------------------------------agc-----tcagac---

Q13794_PMAIP1-01       ------------ccgcgcgggctcc-------------------------
Q13794_PMAIP1-02       ------------ccgcgcgggctcc-------------------------
Q13323_BIK-01          ------------ctatggaggac------ttcgattctt-----------
Q92934_BAD-03          ------------ccgcaggggacgggccctcaggctc-------------
Q92934_BAD-04          ------------ccgcaggggacgggccctcaggctc-------------
Q92934_BAD-02          ------------ccgcaggggacgggccctcaggctc-------------
Q92934_BAD-01          ------------ccgcaggggacgggccctcaggctc-------------
B4DZQ9_BAD-01          ------------ccgcaggggacgggccctcaggctc-------------
O00198_HRK-01          ------------cgtccgccg-----------------------------
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         --------------------------------------------------
Q9BXH1_BBC3-03         ------------cccccaccgccccacccgccgtcaccgccgccctgggg
B4DQK3_BBC3-01         ------------cccccaccgccccacccgccgtcaccgccgccctgggg
Q9BXH1_BBC3-06         ------------cccccaccgccccacccgccgtcaccgccgccctgggg
Q96LC9_BMF-05          ccctctcacccactgctgtggccctggccttcgacc--------------
Q96LC9_BMF-07          ccctctcacccactgctgtggccctggccttcgacc--------------
Q96LC9_BMF-04          ccctctcacccactgctgtggccctggccttcgacc--------------
Q96LC9_BMF-03          ccctctcacccactgctgtggccctggccttcgacc--------------
Q96LC9_BMF-02          ccctctcacccactgctgtggccctggccttcgacc--------------
Q96LC9_BMF-01          ccctctcacccactgctgtggccctggccttcgacc--------------
Q96LC9_BMF-06          ccctctcacccactgctgtggccctggccttcgacc--------------
O43521_BCL2L11-11      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-06      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-15      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-23      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-13      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-17      ---------------ctggggcccctacct----cc--------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-08      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-07      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-19      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-21      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-02      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-03      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-24      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-12      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-05      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-25      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-18      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-09      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-16      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-10      ---------------ctggggcccctacct----cc--------------
O43521_BCL2L11-20      ---------------ctggggcccctacct----cc--------------

Q13794_PMAIP1-01       -------------------agcag--------------------------
Q13794_PMAIP1-02       -------------------agcaggaccggcggg----------------
Q13323_BIK-01          --------------tggaatgcatggagggcag-----------------
Q92934_BAD-03          --------------cggcaagcatcatcgccagg----------------
Q92934_BAD-04          --------------cggcaagcatcatcgccagg----------------
Q92934_BAD-02          --------------cggcaagcatcatcgccagg----------------
Q92934_BAD-01          --------------cggcaagcatcatcgccagg----------------
B4DZQ9_BAD-01          --------------cggcaagcatcatcgccagg----------------
O00198_HRK-01          --------------cgcagctcaccgccgcccgg----------------
Q9BXH1_BBC3-04         --------------cgtgggtcccct--gccaga----------------
Q9BXH1_BBC3-05         --------------cgtgggtcccct--gccaga----------------
Q9BXH1_BBC3-03         ggttcccgctggcctgggggtccccgcagccggc----------------
B4DQK3_BBC3-01         ggttcccgctggcctgggggtccccgcagccggc----------------
Q9BXH1_BBC3-06         ggttcccgctggcctgggggtccccgcagccggc----------------
Q96LC9_BMF-05          --------------caccagccaggaagacaaagctacccagactctcag
Q96LC9_BMF-07          --------------caccagccaggaagacaaagctacccagactctcag
Q96LC9_BMF-04          --------------caccagccaggaagacaaagctacccagactctcag
Q96LC9_BMF-03          --------------caccagccaggaagacaaagctacccagactctcag
Q96LC9_BMF-02          --------------caccagccaggaagacaaagctacccagactctcag
Q96LC9_BMF-01          --------------caccagccaggaagacaaagctacccagactctcag
Q96LC9_BMF-06          --------------caccagccaggaagacaaagctacccagactctcag
O43521_BCL2L11-11      --------------ctacagacagagccacaagt----------------
O43521_BCL2L11-06      --------------ctacagacagagccaca-------------------
O43521_BCL2L11-15      --------------ctacagacagagccaca-------------------
O43521_BCL2L11-23      --------------ctacagacagagccaca-------------------
O43521_BCL2L11-13      --------------ctacagacagagccacaa------------------
O43521_BCL2L11-17      --------------ctacagacagagccacaa------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      --------------ctacagacagagccacaaggtaatcctgaaggcaat
O43521_BCL2L11-08      --------------ctacagacagagccacaaggtaatcctgaaggcaat
O43521_BCL2L11-07      --------------ctacagacagagccaca-------------------
O43521_BCL2L11-19      --------------ctacagacagagccaca-------------------
O43521_BCL2L11-21      --------------ctacagacagagccacaaggtaatcctgaaggcaat
O43521_BCL2L11-02      --------------ctacagacagagccaca-------------------
O43521_BCL2L11-03      --------------ctacagacagagccacaaggtaatcctgaaggcaat
O43521_BCL2L11-24      --------------ctacagacagagccacaaggtaatcctgaaggcaat
O43521_BCL2L11-12      --------------ctacagacagagccacaaggtaatcctgaaggcaat
O43521_BCL2L11-05      --------------ctacagacagagccaca-------------------
O43521_BCL2L11-25      --------------ctacagacagagccaca-------------------
O43521_BCL2L11-18      --------------ctacagacagagccacaaggtaatcctgaaggcaat
O43521_BCL2L11-09      --------------ctacagacagagccacaaggtaatcctgaaggcaat
O43521_BCL2L11-16      --------------ctacagacagagccacaaggtaatcctgaaggcaat
O43521_BCL2L11-10      --------------ctacagacagagccacaa------------------
O43521_BCL2L11-20      --------------ctacagacagagccacaa------------------

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       --------------------------------------------------
Q13323_BIK-01          --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
O00198_HRK-01          --------------------------------------------------
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         --------------------------------------------------
Q9BXH1_BBC3-03         --------------------------------------------------
B4DQK3_BBC3-01         --------------------------------------------------
Q9BXH1_BBC3-06         --------------------------------------------------
Q96LC9_BMF-05          cccag---------------------------------------------
Q96LC9_BMF-07          cccag---------------------------------------------
Q96LC9_BMF-04          cccag---------------------------------------------
Q96LC9_BMF-03          cccag---------------------------------------------
Q96LC9_BMF-02          cccag---------------------------------------------
Q96LC9_BMF-01          cccag---------------------------------------------
Q96LC9_BMF-06          cccag---------------------------------------------
O43521_BCL2L11-11      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-13      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      cacggaggtgaaggggacagctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-08      cacggaggtgaaggggacagctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-21      cacggaggtgaaggggacagctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-02      --------------------------------------------------
O43521_BCL2L11-03      cacggaggtgaaggggacagctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-24      cacggaggtgaaggggacagctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-12      cacggaggtgaaggggacagctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-05      --------------------------------------------------
O43521_BCL2L11-25      --------------------------------------------------
O43521_BCL2L11-18      cacggaggtgaaggggacagctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-09      cacggaggtgaaggggacagctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-16      cacggaggtgaaggggacagctgcccccacggcagccctcagggcccgct
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       --------------------------------------------------
Q13323_BIK-01          --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
O00198_HRK-01          --------------------------------------------------
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         --------------------------------------------------
Q9BXH1_BBC3-03         --------------------------------------------------
B4DQK3_BBC3-01         --------------------------------------------------
Q9BXH1_BBC3-06         --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
O43521_BCL2L11-11      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-13      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-08      ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-21      ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-02      --------------------------------------------------
O43521_BCL2L11-03      ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-24      ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-12      ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-05      --------------------------------------------------
O43521_BCL2L11-25      --------------------------------------------------
O43521_BCL2L11-18      ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-09      ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-16      ggccccacctgccagccctggcccttttgctaccagatccccgcttttca
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       --------------------------------------------------
Q13323_BIK-01          --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
O00198_HRK-01          --------------------------------------------------
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         --------------------------------------------------
Q9BXH1_BBC3-03         --------------------------------------------------
B4DQK3_BBC3-01         --------------------------------------------------
Q9BXH1_BBC3-06         --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
O43521_BCL2L11-11      ----------------------------------------------ctca
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-13      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      tctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttc
O43521_BCL2L11-08      tctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttc
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-21      tctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttc
O43521_BCL2L11-02      --------------------------------------------------
O43521_BCL2L11-03      tctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttc
O43521_BCL2L11-24      tctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttc
O43521_BCL2L11-12      tctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttc
O43521_BCL2L11-05      --------------------------------------------------
O43521_BCL2L11-25      --------------------------------------------------
O43521_BCL2L11-18      tctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttc
O43521_BCL2L11-09      tctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttc
O43521_BCL2L11-16      tctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttc
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       tacggcgggtacggcgagggaccaagccggatttgcgattgggatgcagc
Q13323_BIK-01          --tgacgcattggccctgcggctggcctgcatcggggacg---agatgga
Q92934_BAD-03          ccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagc
Q92934_BAD-04          ccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagc
Q92934_BAD-02          ccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagc
Q92934_BAD-01          ccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagc
B4DZQ9_BAD-01          ccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagc
O00198_HRK-01          ctcaaggcgctaggc--gacg---agctgca-ccagcgca-ccatgtggc
Q9BXH1_BBC3-04         tttg----------------------------------------------
Q9BXH1_BBC3-05         tttg---------------tg---gtcctcagccctcgct-ctcgctggc
Q9BXH1_BBC3-03         cccgaggcccgcgcccggacg---gtcctcagccctcgct-ctcgctggc
B4DQK3_BBC3-01         cccgaggcccgcgcccggacg---gtcctcagccctcgct-ctcgctggc
Q9BXH1_BBC3-06         cccgaggcccgcgcccggacg---gtcctcagccctcgct-ctcgctggc
Q96LC9_BMF-05          ---cctcccccagccaaggtgtcatgctgccttgtggggtgactgaggaa
Q96LC9_BMF-07          ---cctcccccagccaaggtgtcatgctgccttgtggggtgactgaggaa
Q96LC9_BMF-04          ---cctcccccagccaaggtgtcatgctgccttgtggggtgactgaggaa
Q96LC9_BMF-03          ---cctcccccagccaaggtgtcatgctgccttgtggggtgactgaggaa
Q96LC9_BMF-02          ---cctcccccagccaaggtgtcatgctgccttgtggggtgactgaggaa
Q96LC9_BMF-01          ---cctcccccagccaaggtgtcatgctgccttgtggggtgactgaggaa
Q96LC9_BMF-06          ---cctcccccagccaaggtgtcatgctgccttgtggggtgactgaggaa
O43521_BCL2L11-11      ctctgtcacccaggc-tggagt---gcactggtgcgatct--tggctcac
O43521_BCL2L11-06      -----------agac-aggagcccagcacccatgagttgtgacaaatcaa
O43521_BCL2L11-15      -----------agac-aggagcccagcacccatgagttgtgacaaatcaa
O43521_BCL2L11-23      -----------agac-aggagcccagcacccatgagttgtgacaaatcaa
O43521_BCL2L11-13      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      tcttttgacacagac-aggagcccagcacccatgagttgtgacaaatcaa
O43521_BCL2L11-08      tcttttgacacagac-aggagcccagcacccatgagttgtgacaaatcaa
O43521_BCL2L11-07      -----------agac-aggagcccagcacccatgagttgtgacaaatcaa
O43521_BCL2L11-19      -----------agac-aggagcccagcacccatgagttgtgacaaatcaa
O43521_BCL2L11-21      tcttttgacacagac-aggagcccagcacccatgagttgtgacaaatcaa
O43521_BCL2L11-02      -----------agac-aggagcccagcacccatgagttgtgacaaatcaa
O43521_BCL2L11-03      tcttttgacacagac-aggagcccagcacccatgagttgtgacaaatcaa
O43521_BCL2L11-24      tcttttgacacagac-aggagcccagcacccatgagttgtgacaaatcaa
O43521_BCL2L11-12      tcttttgacacagac-aggagcccagcacccatgagttgtgacaaatcaa
O43521_BCL2L11-05      -----------agac-aggagcccagcacccatgagttgtgacaaatcaa
O43521_BCL2L11-25      -----------agac-aggagcccagcacccatgagttgtgacaaatcaa
O43521_BCL2L11-18      tcttttgacacagac-aggagcccagcacccatgagttgtgacaaatcaa
O43521_BCL2L11-09      tcttttgacacagac-aggagcccagcacccatgagttgtgacaaatcaa
O43521_BCL2L11-16      tcttttgacacagac-aggagcccagcacccatgagttgtgacaaatcaa
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       tgcgtttcaccaggggcaaaaagctcctttcctcctctctttcctcctcg
Q13323_BIK-01          cgtgagcctcagg-------------------------------------
Q92934_BAD-03          agcagccatcatggagaagggacttcctcgccc-----------------
Q92934_BAD-04          agcagccatcatggagggagaacttcgtattctccttcttgggaatctga
Q92934_BAD-02          agcagccatcatg-------------------------------------
Q92934_BAD-01          agcagccatcatg-------------------------------------
B4DZQ9_BAD-01          agcagccatcatg-------------------------------------
O00198_HRK-01          ggcgccgcgcgcg-------------------------------------
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         ggagcagcacctg-------------------------------------
Q9BXH1_BBC3-03         ggagcagcacctg-------------------------------------
B4DQK3_BBC3-01         ggagcagcacctg-------------------------------------
Q9BXH1_BBC3-06         ggagcagcacctg-------------------------------------
Q96LC9_BMF-05          ccccag---c----------------------------------------
Q96LC9_BMF-07          ccccag---c----------------------------------------
Q96LC9_BMF-04          ccccag---c----------------------------------------
Q96LC9_BMF-03          ccccag---c----------------------------------------
Q96LC9_BMF-02          ccccag---c----------------------------------------
Q96LC9_BMF-01          ccccag---c----------------------------------------
Q96LC9_BMF-06          ccccag---c----------------------------------------
O43521_BCL2L11-11      tgcaacctcc----------------------------------------
O43521_BCL2L11-06      cacaaacccc----------------------------------------
O43521_BCL2L11-15      cacaaacccc----------------------------------------
O43521_BCL2L11-23      cacaaacccc----------------------------------------
O43521_BCL2L11-13      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      cacaaacccc----------------------------------------
O43521_BCL2L11-08      cacaaacccc----------------------------------------
O43521_BCL2L11-07      cacaaacccc----------------------------------------
O43521_BCL2L11-19      cacaaacccc----------------------------------------
O43521_BCL2L11-21      cacaaacccc----------------------------------------
O43521_BCL2L11-02      cacaaacccc----------------------------------------
O43521_BCL2L11-03      cacaaacccc----------------------------------------
O43521_BCL2L11-24      cacaaacccc----------------------------------------
O43521_BCL2L11-12      cacaaacccc----------------------------------------
O43521_BCL2L11-05      cacaaacccc----------------------------------------
O43521_BCL2L11-25      cacaaacccc----------------------------------------
O43521_BCL2L11-18      cacaaacccc----------------------------------------
O43521_BCL2L11-09      cacaaacccc----------------------------------------
O43521_BCL2L11-16      cacaaacccc----------------------------------------
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------

Q13794_PMAIP1-01       -----------------------------------------agctgg---
Q13794_PMAIP1-02       ccacttgcccttccccggggccacgaggaacaagtgcaagtagctgg---
Q13323_BIK-01          --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
Q92934_BAD-04          ggactctgaaaatcccagtgcagggatgctcgcggaagcatcagcaggga
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
O00198_HRK-01          --------------------------------------------------
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         --------------------------------------------------
Q9BXH1_BBC3-03         --------------------------------------------------
B4DQK3_BBC3-01         --------------------------------------------------
Q9BXH1_BBC3-06         --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
O43521_BCL2L11-11      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-13      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      --------------------------------------------------
O43521_BCL2L11-08      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-02      --------------------------------------------------
O43521_BCL2L11-03      --------------------------------------------------
O43521_BCL2L11-24      --------------------------------------------------
O43521_BCL2L11-12      --------------------------------------------------
O43521_BCL2L11-05      --------------------------------------------------
O43521_BCL2L11-25      --------------------------------------------------
O43521_BCL2L11-18      --------------------------------------------------
O43521_BCL2L11-09      --------------------------------------------------
O43521_BCL2L11-16      --------------------------------------------------
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       --------------------------------------------------
Q13323_BIK-01          --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
Q92934_BAD-04          tgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaaag
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
O00198_HRK-01          --------------------------------------------------
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         --------------------------------------------------
Q9BXH1_BBC3-03         --------------------------------------------------
B4DQK3_BBC3-01         --------------------------------------------------
Q9BXH1_BBC3-06         --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
O43521_BCL2L11-11      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-13      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      --------------------------------------------------
O43521_BCL2L11-08      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-02      --------------------------------------------------
O43521_BCL2L11-03      --------------------------------------------------
O43521_BCL2L11-24      --------------------------------------------------
O43521_BCL2L11-12      --------------------------------------------------
O43521_BCL2L11-05      --------------------------------------------------
O43521_BCL2L11-25      --------------------------------------------------
O43521_BCL2L11-18      --------------------------------------------------
O43521_BCL2L11-09      --------------------------------------------------
O43521_BCL2L11-16      --------------------------------------------------
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------

Q13794_PMAIP1-01       ---aagtcgagtgtgctactcaactcaggagattt---------------
Q13794_PMAIP1-02       ---aagtcgagtgtgctactcaactcaggagattt---------------
Q13323_BIK-01          ---gccccgcgcctggcccagctctccgaggtggc-catgcacagcc---
Q92934_BAD-03          ---gaagagcgcgggc-acagcaacgcagatgcgg-----caaagctcca
Q92934_BAD-04          ctagaggcgctggggctgtggagatccggagtcgc-----cacagctcct
Q92934_BAD-02          ---gaggcgctggggctgtggagatccggagtcgc-----cacagctcct
Q92934_BAD-01          ---gaggcgctggggctgtggagatccggagtcgc-----cacagctcct
B4DZQ9_BAD-01          ---gaggcgctggggctgtggagatccggagtcgc-----cacagctcct
O00198_HRK-01          ---gagccggagggcg-ccggcgcccggcgcgctc-----------ccca
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         ---gagtcgcccgtgc-ccagcgccccgggggctctggcgggcggtccca
Q9BXH1_BBC3-03         ---gagtcgcccgtgc-ccagcgccccgggggctctggcgggcggtccca
B4DQK3_BBC3-01         ---gagtcgcccgtgc-ccagcgccccgggggctctggcgggcggtccca
Q9BXH1_BBC3-06         ---gagtcgcccgtgc-ccagcgccccgggggctctggcgggcggtccca
Q96LC9_BMF-05          ---gactcttttatg-----------------------------------
Q96LC9_BMF-07          ---gactcttttatg-----------------------------------
Q96LC9_BMF-04          ---gactcttttatggcaatgctggctatcggcttcctctccctgccagt
Q96LC9_BMF-03          ---gactcttttatggcaatgctggctatcggcttcctctccctgccagt
Q96LC9_BMF-02          ---gactcttttatggcaatgctggctatcggcttcctctccctgccagt
Q96LC9_BMF-01          ---gactcttttatggcaatgctggctatcggcttcctctccctgccagt
Q96LC9_BMF-06          ---gactcttttatggcaatgctggctatcggcttcctctccctgccagt
O43521_BCL2L11-11      ---aactcccaagttcaagcggt------------------tc-------
O43521_BCL2L11-06      ---aagtcctccttgccaggcct------------------tcaaccact
O43521_BCL2L11-15      ---aagtcctccttgccaggcct------------------tcaaccact
O43521_BCL2L11-23      ---aagtcctccttgccaggcct------------------tcaaccact
O43521_BCL2L11-13      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      ---aagtcctccttgccaggcct------------------tcaaccact
O43521_BCL2L11-08      ---aagtcctccttgccaggcct------------------tcaaccact
O43521_BCL2L11-07      ---aagtcctccttgccaggcct------------------tcaaccact
O43521_BCL2L11-19      ---aagtcctccttgccaggcct------------------tcaaccact
O43521_BCL2L11-21      ---aagtcctccttgccaggcct------------------tcaaccact
O43521_BCL2L11-02      ---aagtcctccttgccaggcct------------------tcaaccact
O43521_BCL2L11-03      ---aagtcctccttgccaggcct------------------tcaaccact
O43521_BCL2L11-24      ---aagtcctccttgccaggcct------------------tcaaccact
O43521_BCL2L11-12      ---aagtcctccttgccaggcct------------------tcaaccact
O43521_BCL2L11-05      ---aagtcctccttgccaggcct------------------tcaaccact
O43521_BCL2L11-25      ---aagtcctccttgccaggcct------------------tcaaccact
O43521_BCL2L11-18      ---aagtcctccttgccaggcct------------------tcaaccact
O43521_BCL2L11-09      ---aagtcctccttgccaggcct------------------tcaaccact
O43521_BCL2L11-16      ---aagtcctccttgccaggcct------------------tcaaccact
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       --------------------------------------------------
Q13323_BIK-01          ------tgggtctggctttcatc----------------tacgaccagac
Q92934_BAD-03          gct------ggacgcgagtcttccagtcctggtgggatcggaacttgggc
Q92934_BAD-04          accccgcggggacggaggacgac-------gaagggatggg---------
Q92934_BAD-02          accccgcggggacggaggacgac-------gaagggatggg---------
Q92934_BAD-01          accccgcggggacggaggacgac-------gaagggatggg---------
B4DZQ9_BAD-01          accccgcggggacggaggacgac-------gaagggatggg---------
O00198_HRK-01          ccta-ctggccttggctgtgcgc-------gg------------------
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         cccaggcggccccgggagtccgc-------ggggaggaggaacagtgggc
Q9BXH1_BBC3-03         cccaggcggccccgggagtccgc-------ggggaggaggaacagtgggc
B4DQK3_BBC3-01         cccaggcggccccgggagtccgc-------ggggaggaggaacagtgggc
Q9BXH1_BBC3-06         cccaggcggccccgggagtccgc-------ggggaggaggaacagtgggc
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-04          ttcccagcagtcttgcccattgg------------------ggagcagcc
Q96LC9_BMF-03          ttcccagcagtcttgcccattgg------------------ggagcagcc
Q96LC9_BMF-02          ttcccagcagtcttgcccattgg------------------ggagcagcc
Q96LC9_BMF-01          ttcccagcagtcttgcccattgg------------------ggagcagcc
Q96LC9_BMF-06          ttcccagcagtcttgcccattgg------------------ggagcagcc
O43521_BCL2L11-11      --------------------------------------------------
O43521_BCL2L11-06      atctcagtgcaatggtagtcatc------------------ctagaggat
O43521_BCL2L11-15      atctcagtgcaatggtagtcatc------------------ctagaggat
O43521_BCL2L11-23      atctcagtgcaatgga-----t----------------------------
O43521_BCL2L11-13      --------------gc-----tt------------------ccatgaggc
O43521_BCL2L11-17      --------------gc-----tt------------------ccatgaggc
Q6JTU4_BCL2L11-01      ----------------------------------------------aggc
O43521_BCL2L11-22      atctcagtgcaatggt-----t----------------------------
O43521_BCL2L11-08      atctcagtgcaatggt-----t----------------------------
O43521_BCL2L11-07      atctcagtgcaatggt-----t----------------------------
O43521_BCL2L11-19      atctcagtgcaatggt-----t----------------------------
O43521_BCL2L11-21      atctcagtgcaat-------------------------------------
O43521_BCL2L11-02      atctcagtgcaatggc-----tt------------------ccatgaggc
O43521_BCL2L11-03      atctcagtgcaatggc-----tt------------------ccatgaggc
O43521_BCL2L11-24      atctcagtgcaatggc-----t----------------------------
O43521_BCL2L11-12      atctcagtgcaatggc-----t----------------------------
O43521_BCL2L11-05      atctcagtgcaatggc-----tt------------------ccatgaggc
O43521_BCL2L11-25      atctcagtgcaatggc-----tt------------------ccatgaggc
O43521_BCL2L11-18      atctcagtgcaatggc-----tt------------------ccatgaggc
O43521_BCL2L11-09      atctcagtgcaatggc-----tt------------------ccatgaggc
O43521_BCL2L11-16      atctcagtgcaatggc-----tt------------------ccatgaggc
O43521_BCL2L11-10      --------------gc-----tt------------------ccatgaggc
O43521_BCL2L11-20      --------------gc-----tt------------------ccatgaggc

Q13794_PMAIP1-01       -ggagacaaactgaacttccggcagaaacttctgaatctgatatccaaac
Q13794_PMAIP1-02       -ggagacaaactgaacttccggcagaaacttctgaatctgatatccaaac
Q13323_BIK-01          tgaggacatcagggatgttcttagaagtttcatggacggtttcaccacac
Q92934_BAD-03          aggggaagctccgccccctcc-cagtgaccttcgctccacatcccgaaac
Q92934_BAD-04          -ggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaac
Q92934_BAD-02          -ggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaac
Q92934_BAD-01          -ggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaac
B4DZQ9_BAD-01          -ggaggagcccagcccctttcggggccgttcgcgctcggcgccccccaac
O00198_HRK-01          --------------------------------------------ccgcgc
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         ccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcac
Q9BXH1_BBC3-03         ccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcac
B4DQK3_BBC3-01         ccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcac
Q9BXH1_BBC3-06         ccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcac
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-04          ccccgaagggcagtggcaacatcaagcagaggtacagattgcccgaaagc
Q96LC9_BMF-03          ccccgaagggcagtggcaacatcaagcagaggtacagattgcccgaaagc
Q96LC9_BMF-02          ccccgaagggcagtggcaacatcaagcagaggtacagattgcccgaaagc
Q96LC9_BMF-01          ccccgaagggcagtggcaacatcaagcagaggtacagattgcccgaaagc
Q96LC9_BMF-06          ccccgaagggcagtggcaacatcaagcagag-------------------
O43521_BCL2L11-11      ------------------------------------tcctgcctcag---
O43521_BCL2L11-06      ataggtgatctttcactgtgc-tttggatttatatttactggcttagatt
O43521_BCL2L11-15      ataggtgatctttcactgtgc-tttggatttatatttactggcttagatt
O43521_BCL2L11-23      -----gactccgc-------------------tggatcctccctcagaat
O43521_BCL2L11-13      aggctgaacctgcagatatgcgcccagagatatggatc--gcccaagagt
O43521_BCL2L11-17      aggctgaacctgcagatatgcgcccagagatatggatc--gcccaagagt
Q6JTU4_BCL2L11-01      aggctgaacctgcagatatgcgcccagagatatggatc--gcccaagagt
O43521_BCL2L11-22      -------------------------agagaaataga--------ggaagt
O43521_BCL2L11-08      -------------------------agagaaataga--------ggaagt
O43521_BCL2L11-07      -------------------------agagaaataga--------ggaagt
O43521_BCL2L11-19      -------------------------agagaaataga--------ggaagt
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-02      aggctgaacctgcagatatgcgcccagagatatggatc--gcccaagagt
O43521_BCL2L11-03      aggctgaacctgcagatatgcgcccagagatatggatc--gcccaagagt
O43521_BCL2L11-24      -------aactg--------------------------------------
O43521_BCL2L11-12      -------aactg--------------------------------------
O43521_BCL2L11-05      aggctgaacctgcagatatgcgcccagagatatggatc--gcccaagagt
O43521_BCL2L11-25      aggctgaacctgcagatatgcgcccagagatatggatc--gcccaagagt
O43521_BCL2L11-18      aggctgaacctgcagatatgcgcccagagatatggatc--gcccaagagt
O43521_BCL2L11-09      aggctgaacctgcagatatgcgcccagagatatggatc--gcccaagagt
O43521_BCL2L11-16      aggctgaacctgcagatatgcgcccagagatatggatc--gcccaagagt
O43521_BCL2L11-10      aggctgaacctgcagatatgcgcccagagatatggatc--gcccaagagt
O43521_BCL2L11-20      aggctgaacctgcagatatgcgcccagagatatggatc--gcccaagagt

Q13794_PMAIP1-01       tcttctgc---------------------------------------tca
Q13794_PMAIP1-02       tcttctgc---------------------------------------tca
Q13323_BIK-01          -----------------ttaaggagaacataatgaggttctggagatccc
Q92934_BAD-03          tccacccgttcccactgccctgggcagc-catcttgaatatgg----gcg
Q92934_BAD-04          -----------------ctctgggcagcacagc---gctatgg----ccg
Q92934_BAD-02          -----------------ctctgggcagcacagc---gctatgg----ccg
Q92934_BAD-01          -----------------ctctgggcagcacagc---gctatgg----ccg
B4DZQ9_BAD-01          -----------------ctctgggcagcacagc---gctatgg----ccg
O00198_HRK-01          ag--------------------------gtggc---ggcgctg-------
Q9BXH1_BBC3-04         ------------tgagacaagaggagcagcagc---ggcaccg----ccc
Q9BXH1_BBC3-05         agtacgagcggcggagacaagaggagcagcagc---ggcaccg----ccc
Q9BXH1_BBC3-03         agtacgagcggcggagacaagaggagcagcagc---ggcaccg----ccc
B4DQK3_BBC3-01         agtacgagcggcggagacaagaggagcagcagc---ggcaccg----ccc
Q9BXH1_BBC3-06         agtacgagcggcggagacaagaggagcagcagc---ggcaccg----ccc
Q96LC9_BMF-05          --------------------------------------------caccag
Q96LC9_BMF-07          --------------------------------------------caccag
Q96LC9_BMF-04          ttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccag
Q96LC9_BMF-03          ttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccag
Q96LC9_BMF-02          ttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccag
Q96LC9_BMF-01          ttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccag
Q96LC9_BMF-06          --------------------------------------------caccag
O43521_BCL2L11-11      --------------------------------------------------
O43521_BCL2L11-06      tgtatggc------------------------------------caccac
O43521_BCL2L11-15      tgtatggc------------------------------------caccac
O43521_BCL2L11-23      tgccctt----------------------------------------cat
O43521_BCL2L11-13      tgcggcg----------------------------------------tat
O43521_BCL2L11-17      tgcggcg----------------------------------------tat
Q6JTU4_BCL2L11-01      tgcggcg----------------------------------------tat
O43521_BCL2L11-22      tgtcgtg----------------------------------------tag
O43521_BCL2L11-08      tgtcgtg----------------------------------------tag
O43521_BCL2L11-07      tgtcgtg----------------------------------------tag
O43521_BCL2L11-19      tgtcgtg----------------------------------------tag
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-02      tgcggcg----------------------------------------tat
O43521_BCL2L11-03      tgcggcg----------------------------------------tat
O43521_BCL2L11-24      --------------------------------------------------
O43521_BCL2L11-12      --------------------------------------------------
O43521_BCL2L11-05      tgcggcg----------------------------------------tat
O43521_BCL2L11-25      tgcggcg----------------------------------------tat
O43521_BCL2L11-18      tgcggcg----------------------------------------tat
O43521_BCL2L11-09      tgcggcg----------------------------------------tat
O43521_BCL2L11-16      tgcggcg----------------------------------------tat
O43521_BCL2L11-10      tgcggcg----------------------------------------tat
O43521_BCL2L11-20      tgcggcg----------------------------------------tat

Q13794_PMAIP1-01       ggaa-------cctga----------------------------------
Q13794_PMAIP1-02       ggaa-------cctgactgcatcaaaaacttgcatgaggggactccttca
Q13323_BIK-01          cgaa-------ccccgggtcctgggtgtcctgcgaacagg-tgctgctgg
Q92934_BAD-03          gaagtacttccctcaggcctatgcaaaaagaggatccgtgct--------
Q92934_BAD-04          cgag-------ctccggaggatga--------------------------
Q92934_BAD-02          cgag-------ctccggaggatgagtgacgagtttgtggactcctttaag
Q92934_BAD-01          cgag-------ctccggaggatgagtgacgagtttgtggactcctttaag
B4DZQ9_BAD-01          cgag-------ctccggaggatgagtgacgagtttgtggactcctttaag
O00198_HRK-01          -gcg-------gcctgg---------------------------------
Q9BXH1_BBC3-04         ctca-------ccctggagggtcc--------tgtacaatctcatcatgg
Q9BXH1_BBC3-05         ctca-------ccctggagggtcc--------tgtacaatctcatcatgg
Q9BXH1_BBC3-03         ctca-------ccctggagggtcc--------tgtacaatctcatcatgg
B4DQK3_BBC3-01         ctca-------ccctggagggtcc--------tgtacaatctcatcatgg
Q9BXH1_BBC3-06         ctca-------ccctggagggtcc--------tgtacaatctcatcatgg
Q96LC9_BMF-05          caga-------accaaaatcgtgtgtggtggcagatcctcctcttcctgc
Q96LC9_BMF-07          caga-------accaaaatcgtgtgtggtggcagatcctcctcttcctgc
Q96LC9_BMF-04          caga-------accaaaatcgtgtgtggtggcagatcctcctcttcctgc
Q96LC9_BMF-03          caga-------accaaaatcgtgtgtggtggcagatcctcctcttcctgc
Q96LC9_BMF-02          caga-------accaaaatcgtgtgtggtggcagatcctcctcttcctgc
Q96LC9_BMF-01          caga-------accaaaatcgtgtgtggtggcagatcctcctcttcctgc
Q96LC9_BMF-06          caga-------accaaaatcgtgtgtggtggcagatcctcctcttcctgc
O43521_BCL2L11-11      --------------------------------------------------
O43521_BCL2L11-06      cata-------gtcaagatac-----------------------------
O43521_BCL2L11-15      cata-------gtcaagatac-----------------------------
O43521_BCL2L11-23      ---a-------gggaagttca-----------------------------
O43521_BCL2L11-13      tgga-------gacgagttta-----------------------------
O43521_BCL2L11-17      tgga-------gacgagttta-----------------------------
Q6JTU4_BCL2L11-01      cgga-------gacgagttta-----------------------------
O43521_BCL2L11-22      --------------------------------------------------
O43521_BCL2L11-08      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-02      tgga-------gacgagttta-----------------------------
O43521_BCL2L11-03      tgga-------gacgagttta-----------------------------
O43521_BCL2L11-24      --------------------------------------------------
O43521_BCL2L11-12      --------------------------------------------------
O43521_BCL2L11-05      tgga-------gacgagttta-----------------------------
O43521_BCL2L11-25      tgga-------gacgagttta-----------------------------
O43521_BCL2L11-18      tgga-------gacgagttta-----------------------------
O43521_BCL2L11-09      tgga-------gacgagttta-----------------------------
O43521_BCL2L11-16      tgga-------gacgagttta-----------------------------
O43521_BCL2L11-10      tgga-------gacgagttta-----------------------------
O43521_BCL2L11-20      tgga-------gacgagttta-----------------------------

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       aaagagttttctcaggaggtgcacgtttcatcaatttgaagaaagactgc
Q13323_BIK-01          cgctgctgctgctgctgg-------------cgctgctgctgccgctgct
Q92934_BAD-03          ----gtctcctttggagggagggc----------tgacccagattc----
Q92934_BAD-04          --------------------------------------------------
Q92934_BAD-02          aagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggca
Q92934_BAD-01          aagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggca
B4DZQ9_BAD-01          aagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggca
O00198_HRK-01          -----ctgctc---------ggc-------------aggcggaacttg--
Q9BXH1_BBC3-04         gactcctgcccttacccaggggccacagagcccccgagatggagcccaat
Q9BXH1_BBC3-05         gactcctgcccttacccaggggccacagagcccccgagatggagcccaat
Q9BXH1_BBC3-03         gactcctgcccttacccaggggccacagagcccccgagatggagcccaat
B4DQK3_BBC3-01         gactcctgcccttacccaggggccacagagcccccgagatggagcccaat
Q9BXH1_BBC3-06         gactcctgcccttacccaggggccacagagcccccgagatggagcccaat
Q96LC9_BMF-05          acaaccttgctttgaatggagaagagaacaggaacggggcaggccctag-
Q96LC9_BMF-07          acaaccttgctttgaatggagaagagaacaggaacggggcaggccctag-
Q96LC9_BMF-04          acaaccttgctttgaatggagaagagaacaggaacggggcaggccctagg
Q96LC9_BMF-03          acaaccttgctttgaatggagaagagaacaggaacggggcaggccctagg
Q96LC9_BMF-02          acaaccttgctttgaatggagaagagaacaggaacggggcaggccctagg
Q96LC9_BMF-01          acaaccttgctttgaatggagaagagaacaggaacggggcaggccctagg
Q96LC9_BMF-06          acaaccttgctttgaatggagaagagaacaggaacggggcaggccctagg
O43521_BCL2L11-11      ---------cctcccaagtag-----------------------------
O43521_BCL2L11-06      --agaacaactcaaccacaaggatttctcatga-----------------
O43521_BCL2L11-15      --agaacaactcaaccacaaggatttctcatga-----------------
O43521_BCL2L11-23      --gtggccact---caagtggttagcaaaatcaagctaa-----------
O43521_BCL2L11-13      --acgcttactatgcaaggaggctggcaaaactcctggcatcctccacct
O43521_BCL2L11-17      --acgcttactatgcaaggaggctggcaaaactcctggcatcctccacct
Q6JTU4_BCL2L11-01      --acgcttactatgcaaggaggtt---------agagaaatag-------
O43521_BCL2L11-22      --------------------------------------------------
O43521_BCL2L11-08      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-21      --------------------gggtatttt-------tgaataa-------
O43521_BCL2L11-02      --acgcttactatgcaaggagggtatttt-------tgaataattaccaa
O43521_BCL2L11-03      --acgcttactatgcaaggagggtatttt-------tgaataattaccaa
O43521_BCL2L11-24      ------------------------------------ggactag-------
O43521_BCL2L11-12      ------------------------------------ggactag-------
O43521_BCL2L11-05      --acgcttactatgcaaggaggtt---------agagaaatag-------
O43521_BCL2L11-25      --acgcttactatgcaaggaggtt---------agagaaatag-------
O43521_BCL2L11-18      --acgcttactatgcaaggaggtt---------agagaaatag-------
O43521_BCL2L11-09      --acgcttactatgcaaggaggatgcctcttccacctgattaa-------
O43521_BCL2L11-16      --acgcttactatgcaaggaggatgcctcttccacctgattaa-------
O43521_BCL2L11-10      --acgcttactatgcaaggaggatgcctcttccacctgattaa-------
O43521_BCL2L11-20      --acgcttactatgcaaggaggatgcctcttccacctgattaa-------

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       attgtaattga---------------------------------------
Q13323_BIK-01          cag-----------------------------------------------
Q92934_BAD-03          --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
Q92934_BAD-02          aag-------------------------ctccagctggacgcgagtcttc
Q92934_BAD-01          aag-------------------------ctccagctggacgcgagtcttc
B4DZQ9_BAD-01          aag-------------------------cccca-----------------
O00198_HRK-01          tag-----------------------------------------------
Q9BXH1_BBC3-04         taggtgcctgcacccgcccggtggacgtcagggactcggggggcaggccc
Q9BXH1_BBC3-05         tag-----------------------------------------------
Q9BXH1_BBC3-03         taggtgcctgcacccgcccggtggacgtcagggactcggggggcaggccc
B4DQK3_BBC3-01         tag-----------------------------------------------
Q9BXH1_BBC3-06         tag-----------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-04          tga-----------------------------------------------
Q96LC9_BMF-03          tga-----------------------------------------------
Q96LC9_BMF-02          tga-----------------------------------------------
Q96LC9_BMF-01          tga-----------------------------------------------
Q96LC9_BMF-06          tga-----------------------------------------------
O43521_BCL2L11-11      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-13      ga------------------------------------------------
O43521_BCL2L11-17      ga------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      --------------------------------------------------
O43521_BCL2L11-08      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-02      gcagccgaagaccacccacgaatggttatcttacgactgttacgttacat
O43521_BCL2L11-03      gcagccgaagaccacccacgaatggttatcttacgactgttacgttacat
O43521_BCL2L11-24      --------------------------------------------------
O43521_BCL2L11-12      --------------------------------------------------
O43521_BCL2L11-05      --------------------------------------------------
O43521_BCL2L11-25      --------------------------------------------------
O43521_BCL2L11-18      --------------------------------------------------
O43521_BCL2L11-09      --------------------------------------------------
O43521_BCL2L11-16      --------------------------------------------------
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       --------------------------------------------------
Q13323_BIK-01          --------------------------cgggggcctgcacctgctgctcaa
Q92934_BAD-03          -------------------------------------ccttccggtgcgt
Q92934_BAD-04          --------------------------------------------------
Q92934_BAD-02          cagtcctggtgggatcggaacttgggcaggggaagctccgccccctccca
Q92934_BAD-01          cagtcctggtgggatcggaacttgggcaggggaagctccgccccctccca
B4DZQ9_BAD-01          ----------------ggcgcctgcgc-----------------------
O00198_HRK-01          --------------------------------------------------
Q9BXH1_BBC3-04         ctcccacctcctgacaccctggccagcgcgggggactttctctgcaccat
Q9BXH1_BBC3-05         --------------------------------------------------
Q9BXH1_BBC3-03         ctcccacctcctgacaccctggccagcgcgggggactttctctgcaccat
B4DQK3_BBC3-01         --------------------------------------------------
Q9BXH1_BBC3-06         --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
O43521_BCL2L11-11      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-13      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      --------------------------------------------------
O43521_BCL2L11-08      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-02      tgtccgcctggtgtggagaatgcattga----------------------
O43521_BCL2L11-03      tgtccgcctggtgtggagaatgcattga----------------------
O43521_BCL2L11-24      --------------------------------------------------
O43521_BCL2L11-12      --------------------------------------------------
O43521_BCL2L11-05      --------------------------------------------------
O43521_BCL2L11-25      --------------------------------------------------
O43521_BCL2L11-18      --------------------------------------------------
O43521_BCL2L11-09      --------------------------------------------------
O43521_BCL2L11-16      --------------------------------------------------
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------

Q13794_PMAIP1-01       ----
Q13794_PMAIP1-02       ----
Q13323_BIK-01          gtga
Q92934_BAD-03          gtga
Q92934_BAD-04          ----
Q92934_BAD-02          gtga
Q92934_BAD-01          gtga
B4DZQ9_BAD-01          -taa
O00198_HRK-01          ----
Q9BXH1_BBC3-04         gtag
Q9BXH1_BBC3-05         ----
Q9BXH1_BBC3-03         gtag
B4DQK3_BBC3-01         ----
Q9BXH1_BBC3-06         ----
Q96LC9_BMF-05          ----
Q96LC9_BMF-07          ----
Q96LC9_BMF-04          ----
Q96LC9_BMF-03          ----
Q96LC9_BMF-02          ----
Q96LC9_BMF-01          ----
Q96LC9_BMF-06          ----
O43521_BCL2L11-11      ----
O43521_BCL2L11-06      ----
O43521_BCL2L11-15      ----
O43521_BCL2L11-23      ----
O43521_BCL2L11-13      ----
O43521_BCL2L11-17      ----
Q6JTU4_BCL2L11-01      ----
O43521_BCL2L11-22      ----
O43521_BCL2L11-08      ----
O43521_BCL2L11-07      ----
O43521_BCL2L11-19      ----
O43521_BCL2L11-21      ----
O43521_BCL2L11-02      ----
O43521_BCL2L11-03      ----
O43521_BCL2L11-24      ----
O43521_BCL2L11-12      ----
O43521_BCL2L11-05      ----
O43521_BCL2L11-25      ----
O43521_BCL2L11-18      ----
O43521_BCL2L11-09      ----
O43521_BCL2L11-16      ----
O43521_BCL2L11-10      ----
O43521_BCL2L11-20      ----

© 1998-2019