Dataset for CDS BMF of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q96LC9_BMF-05      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggg
Q96LC9_BMF-07      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggg
Q96LC9_BMF-01      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggg
Q96LC9_BMF-03      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggg
Q96LC9_BMF-04      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggg
Q96LC9_BMF-02      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggg
Q96LC9_BMF-06      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggg
                   ************************************************************

Q96LC9_BMF-05      gagccggtgacccaacccgggagcttgctctctgctgacctgtttgcccagagcctactg
Q96LC9_BMF-07      gagccggtgacccaacccgggagcttgctctctgctgacctgtttgcccagagcctactg
Q96LC9_BMF-01      gagccggtgacccaacccgggagcttgctctctgctgacctgtttgcccagagcctactg
Q96LC9_BMF-03      gagccggtgacccaacccgggagcttgctctctgctgacctgtttgcccagagcctactg
Q96LC9_BMF-04      gagccggtgacccaacccgggagcttgctctctgctgacctgtttgcccagagcctactg
Q96LC9_BMF-02      gagccggtgacccaacccgggagcttgctctctgctgacctgtttgcccagagcctactg
Q96LC9_BMF-06      gagccggtgacccaacccgggagcttgctctctgctgacctgtttgcccagagcctactg
                   ************************************************************

Q96LC9_BMF-05      gactgccccctcagccgacttcagctcttccctctcacccactgctgtggccctggcctt
Q96LC9_BMF-07      gactgccccctcagccgacttcagctcttccctctcacccactgctgtggccctggcctt
Q96LC9_BMF-01      gactgccccctcagccgacttcagctcttccctctcacccactgctgtggccctggcctt
Q96LC9_BMF-03      gactgccccctcagccgacttcagctcttccctctcacccactgctgtggccctggcctt
Q96LC9_BMF-04      gactgccccctcagccgacttcagctcttccctctcacccactgctgtggccctggcctt
Q96LC9_BMF-02      gactgccccctcagccgacttcagctcttccctctcacccactgctgtggccctggcctt
Q96LC9_BMF-06      gactgccccctcagccgacttcagctcttccctctcacccactgctgtggccctggcctt
                   ************************************************************

Q96LC9_BMF-05      cgacccaccagccaggaagacaaagctacccagactctcagcccagcctcccccagccaa
Q96LC9_BMF-07      cgacccaccagccaggaagacaaagctacccagactctcagcccagcctcccccagccaa
Q96LC9_BMF-01      cgacccaccagccaggaagacaaagctacccagactctcagcccagcctcccccagccaa
Q96LC9_BMF-03      cgacccaccagccaggaagacaaagctacccagactctcagcccagcctcccccagccaa
Q96LC9_BMF-04      cgacccaccagccaggaagacaaagctacccagactctcagcccagcctcccccagccaa
Q96LC9_BMF-02      cgacccaccagccaggaagacaaagctacccagactctcagcccagcctcccccagccaa
Q96LC9_BMF-06      cgacccaccagccaggaagacaaagctacccagactctcagcccagcctcccccagccaa
                   ************************************************************

Q96LC9_BMF-05      ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatg--------
Q96LC9_BMF-07      ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatg--------
Q96LC9_BMF-01      ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgct
Q96LC9_BMF-03      ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgct
Q96LC9_BMF-04      ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgct
Q96LC9_BMF-02      ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgct
Q96LC9_BMF-06      ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgct
                   ****************************************************        

Q96LC9_BMF-05      ------------------------------------------------------------
Q96LC9_BMF-07      ------------------------------------------------------------
Q96LC9_BMF-01      ggctatcggcttcctctccctgccagtttcccagcagtcttgcccattggggagcagccc
Q96LC9_BMF-03      ggctatcggcttcctctccctgccagtttcccagcagtcttgcccattggggagcagccc
Q96LC9_BMF-04      ggctatcggcttcctctccctgccagtttcccagcagtcttgcccattggggagcagccc
Q96LC9_BMF-02      ggctatcggcttcctctccctgccagtttcccagcagtcttgcccattggggagcagccc
Q96LC9_BMF-06      ggctatcggcttcctctccctgccagtttcccagcagtcttgcccattggggagcagccc
                                                                               

Q96LC9_BMF-05      ------------------------------------------------------------
Q96LC9_BMF-07      ------------------------------------------------------------
Q96LC9_BMF-01      cccgaagggcagtggcaacatcaagcagaggtacagattgcccgaaagcttcagtgcatt
Q96LC9_BMF-03      cccgaagggcagtggcaacatcaagcagaggtacagattgcccgaaagcttcagtgcatt
Q96LC9_BMF-04      cccgaagggcagtggcaacatcaagcagaggtacagattgcccgaaagcttcagtgcatt
Q96LC9_BMF-02      cccgaagggcagtggcaacatcaagcagaggtacagattgcccgaaagcttcagtgcatt
Q96LC9_BMF-06      cccgaagggcagtggcaacatcaagcagag------------------------------
                                                                               

Q96LC9_BMF-05      ---------------------------------caccagcagaaccaaaatcgtgtgtgg
Q96LC9_BMF-07      ---------------------------------caccagcagaaccaaaatcgtgtgtgg
Q96LC9_BMF-01      gcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccaaaatcgtgtgtgg
Q96LC9_BMF-03      gcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccaaaatcgtgtgtgg
Q96LC9_BMF-04      gcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccaaaatcgtgtgtgg
Q96LC9_BMF-02      gcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccaaaatcgtgtgtgg
Q96LC9_BMF-06      ---------------------------------caccagcagaaccaaaatcgtgtgtgg
                                                    ***************************

Q96LC9_BMF-05      tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggg
Q96LC9_BMF-07      tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggg
Q96LC9_BMF-01      tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggg
Q96LC9_BMF-03      tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggg
Q96LC9_BMF-04      tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggg
Q96LC9_BMF-02      tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggg
Q96LC9_BMF-06      tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggg
                   ************************************************************

Q96LC9_BMF-05      gcaggccctag----
Q96LC9_BMF-07      gcaggccctag----
Q96LC9_BMF-01      gcaggccctaggtga
Q96LC9_BMF-03      gcaggccctaggtga
Q96LC9_BMF-04      gcaggccctaggtga
Q96LC9_BMF-02      gcaggccctaggtga
Q96LC9_BMF-06      gcaggccctaggtga
                   ***********    

© 1998-2019