Dataset for CDS BCL2L11 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

23 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O43521_BCL2L11-11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-06      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-15      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-23      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-13      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-17      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
Q6JTU4_BCL2L11-01      atg-----------------------------------------------
O43521_BCL2L11-22      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-08      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-19      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-07      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-21      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-02      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-03      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-12      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-24      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-25      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-05      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-18      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-10      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-20      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-09      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-16      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
                       ***                                               

O43521_BCL2L11-11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-06      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-15      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-23      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-13      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-17      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-08      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-19      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-07      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-21      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-02      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-03      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-12      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-24      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-25      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-05      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-18      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-10      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-20      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-09      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-16      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
                                                                         

O43521_BCL2L11-11      cctccctacagacagagccacaagt-------------------------
O43521_BCL2L11-06      cctccctacagacagagccaca----------------------------
O43521_BCL2L11-15      cctccctacagacagagccaca----------------------------
O43521_BCL2L11-23      cctccctacagacagagccaca----------------------------
O43521_BCL2L11-13      cctccctacagacagagccacaa---------------------------
O43521_BCL2L11-17      cctccctacagacagagccacaa---------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-08      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-19      cctccctacagacagagccaca----------------------------
O43521_BCL2L11-07      cctccctacagacagagccaca----------------------------
O43521_BCL2L11-21      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-02      cctccctacagacagagccaca----------------------------
O43521_BCL2L11-03      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-12      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-24      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-25      cctccctacagacagagccaca----------------------------
O43521_BCL2L11-05      cctccctacagacagagccaca----------------------------
O43521_BCL2L11-18      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-10      cctccctacagacagagccacaa---------------------------
O43521_BCL2L11-20      cctccctacagacagagccacaa---------------------------
O43521_BCL2L11-09      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-16      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
                                                                         

O43521_BCL2L11-11      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-13      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-08      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-21      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-02      --------------------------------------------------
O43521_BCL2L11-03      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-12      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-24      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-25      --------------------------------------------------
O43521_BCL2L11-05      --------------------------------------------------
O43521_BCL2L11-18      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
O43521_BCL2L11-09      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-16      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
                                                                         

O43521_BCL2L11-11      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-13      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-08      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-21      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-02      --------------------------------------------------
O43521_BCL2L11-03      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-12      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-24      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-25      --------------------------------------------------
O43521_BCL2L11-05      --------------------------------------------------
O43521_BCL2L11-18      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
O43521_BCL2L11-09      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-16      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
                                                                         

O43521_BCL2L11-11      -------------------------------------ctcactctgtcac
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-13      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-08      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-21      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-02      --------------------------------------------------
O43521_BCL2L11-03      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-12      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-24      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-25      --------------------------------------------------
O43521_BCL2L11-05      --------------------------------------------------
O43521_BCL2L11-18      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
O43521_BCL2L11-09      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-16      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
                                                                         

O43521_BCL2L11-11      ccaggctggagt---gcactggtgcgatct--tggctcactgcaacctcc
O43521_BCL2L11-06      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-15      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-23      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-13      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-08      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-19      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-07      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-21      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-02      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-03      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-12      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-24      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-25      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-05      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-18      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
O43521_BCL2L11-09      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-16      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                                                                         

O43521_BCL2L11-11      aactcc--------------------------------------------
O43521_BCL2L11-06      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtca
O43521_BCL2L11-15      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtca
O43521_BCL2L11-23      aagtcctccttgccaggccttcaaccactatctcagtgcaatgga-----
O43521_BCL2L11-13      -------------------------------------------gc-----
O43521_BCL2L11-17      -------------------------------------------gc-----
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      aagtcctccttgccaggccttcaaccactatctcagtgcaatggt-----
O43521_BCL2L11-08      aagtcctccttgccaggccttcaaccactatctcagtgcaatggt-----
O43521_BCL2L11-19      aagtcctccttgccaggccttcaaccactatctcagtgcaatggt-----
O43521_BCL2L11-07      aagtcctccttgccaggccttcaaccactatctcagtgcaatggt-----
O43521_BCL2L11-21      aagtcctccttgccaggccttcaaccactatctcagtgcaat--------
O43521_BCL2L11-02      aagtcctccttgccaggccttcaaccactatctcagtgcaatggc-----
O43521_BCL2L11-03      aagtcctccttgccaggccttcaaccactatctcagtgcaatggc-----
O43521_BCL2L11-12      aagtcctccttgccaggccttcaaccactatctcagtgcaatggc-----
O43521_BCL2L11-24      aagtcctccttgccaggccttcaaccactatctcagtgcaatggc-----
O43521_BCL2L11-25      aagtcctccttgccaggccttcaaccactatctcagtgcaatggc-----
O43521_BCL2L11-05      aagtcctccttgccaggccttcaaccactatctcagtgcaatggc-----
O43521_BCL2L11-18      aagtcctccttgccaggccttcaaccactatctcagtgcaatggc-----
O43521_BCL2L11-10      -------------------------------------------gc-----
O43521_BCL2L11-20      -------------------------------------------gc-----
O43521_BCL2L11-09      aagtcctccttgccaggccttcaaccactatctcagtgcaatggc-----
O43521_BCL2L11-16      aagtcctccttgccaggccttcaaccactatctcagtgcaatggc-----
                                                                         

O43521_BCL2L11-11      --------------------------------------------------
O43521_BCL2L11-06      tcctagaggatataggtgatctttcactgtgc-tttggatttatatttac
O43521_BCL2L11-15      tcctagaggatataggtgatctttcactgtgc-tttggatttatatttac
O43521_BCL2L11-23      t---------------gactccgc-------------------tggatcc
O43521_BCL2L11-13      ttccatgaggcaggctgaacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-17      ttccatgaggcaggctgaacctgcagatatgcgcccagagatatggatc-
Q6JTU4_BCL2L11-01      -------aggcaggctgaacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-22      t-----------------------------------agagaaatag----
O43521_BCL2L11-08      t-----------------------------------agagaaatag----
O43521_BCL2L11-19      t-----------------------------------agagaaatag----
O43521_BCL2L11-07      t-----------------------------------agagaaatag----
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-02      ttccatgaggcaggctgaacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-03      ttccatgaggcaggctgaacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-12      t-----------------aactg---------------------------
O43521_BCL2L11-24      t-----------------aactg---------------------------
O43521_BCL2L11-25      ttccatgaggcaggctgaacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-05      ttccatgaggcaggctgaacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-18      ttccatgaggcaggctgaacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-10      ttccatgaggcaggctgaacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-20      ttccatgaggcaggctgaacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-09      ttccatgaggcaggctgaacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-16      ttccatgaggcaggctgaacctgcagatatgcgcccagagatatggatc-
                                                                         

O43521_BCL2L11-11      -------------------------------caagttcaagcggttctc-
O43521_BCL2L11-06      tggcttagatttgtatggccaccaccatagtcaagatacagaacaactca
O43521_BCL2L11-15      tggcttagatttgtatggccaccaccatagtcaagatacagaacaactca
O43521_BCL2L11-23      tccctcagaattgccctt----cataggg---aagttcagtggccactc-
O43521_BCL2L11-13      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-17      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
Q6JTU4_BCL2L11-01      -gcccaagagttgcggcg----tatcggagacgagtttaacgcttactat
O43521_BCL2L11-22      --------------------------------------------------
O43521_BCL2L11-08      --------------------------------------------------
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-02      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-03      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-12      --------------------------------------------------
O43521_BCL2L11-24      --------------------------------------------------
O43521_BCL2L11-25      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-05      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-18      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-10      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-20      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-09      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-16      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
                                                                         

O43521_BCL2L11-11      ---------ctgcctcagcctcccaagtag--------------------
O43521_BCL2L11-06      accacaaggatttctc----------atga--------------------
O43521_BCL2L11-15      accacaaggatttctc----------atga--------------------
O43521_BCL2L11-23      ---aagtggttagcaaaatc---aagctaa--------------------
O43521_BCL2L11-13      gcaaggaggctggcaaaactcctggcatcctccacctga-----------
O43521_BCL2L11-17      gcaaggaggctggcaaaactcctggcatcctccacctga-----------
Q6JTU4_BCL2L11-01      gcaaggaggtt---------agagaaatag--------------------
O43521_BCL2L11-22      ---aggaagttgt----------cgtgtag--------------------
O43521_BCL2L11-08      ---aggaagttgt----------cgtgtag--------------------
O43521_BCL2L11-19      ---aggaagttgt----------cgtgtag--------------------
O43521_BCL2L11-07      ---aggaagttgt----------cgtgtag--------------------
O43521_BCL2L11-21      -------gggtatttt-------tgaataa--------------------
O43521_BCL2L11-02      gcaaggagggtatttt-------tgaataattaccaagcagccgaagacc
O43521_BCL2L11-03      gcaaggagggtatttt-------tgaataattaccaagcagccgaagacc
O43521_BCL2L11-12      -----------------------ggactag--------------------
O43521_BCL2L11-24      -----------------------ggactag--------------------
O43521_BCL2L11-25      gcaaggaggtt---------agagaaatag--------------------
O43521_BCL2L11-05      gcaaggaggtt---------agagaaatag--------------------
O43521_BCL2L11-18      gcaaggaggtt---------agagaaatag--------------------
O43521_BCL2L11-10      gcaaggaggatgcctcttccacctgattaa--------------------
O43521_BCL2L11-20      gcaaggaggatgcctcttccacctgattaa--------------------
O43521_BCL2L11-09      gcaaggaggatgcctcttccacctgattaa--------------------
O43521_BCL2L11-16      gcaaggaggatgcctcttccacctgattaa--------------------
                                                  *                      

O43521_BCL2L11-11      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-13      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-22      --------------------------------------------------
O43521_BCL2L11-08      --------------------------------------------------
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-02      acccacgaatggttatcttacgactgttacgttacattgtccgcctggtg
O43521_BCL2L11-03      acccacgaatggttatcttacgactgttacgttacattgtccgcctggtg
O43521_BCL2L11-12      --------------------------------------------------
O43521_BCL2L11-24      --------------------------------------------------
O43521_BCL2L11-25      --------------------------------------------------
O43521_BCL2L11-05      --------------------------------------------------
O43521_BCL2L11-18      --------------------------------------------------
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
O43521_BCL2L11-09      --------------------------------------------------
O43521_BCL2L11-16      --------------------------------------------------
                                                                         

O43521_BCL2L11-11      ---------------
O43521_BCL2L11-06      ---------------
O43521_BCL2L11-15      ---------------
O43521_BCL2L11-23      ---------------
O43521_BCL2L11-13      ---------------
O43521_BCL2L11-17      ---------------
Q6JTU4_BCL2L11-01      ---------------
O43521_BCL2L11-22      ---------------
O43521_BCL2L11-08      ---------------
O43521_BCL2L11-19      ---------------
O43521_BCL2L11-07      ---------------
O43521_BCL2L11-21      ---------------
O43521_BCL2L11-02      tggagaatgcattga
O43521_BCL2L11-03      tggagaatgcattga
O43521_BCL2L11-12      ---------------
O43521_BCL2L11-24      ---------------
O43521_BCL2L11-25      ---------------
O43521_BCL2L11-05      ---------------
O43521_BCL2L11-18      ---------------
O43521_BCL2L11-10      ---------------
O43521_BCL2L11-20      ---------------
O43521_BCL2L11-09      ---------------
O43521_BCL2L11-16      ---------------
                                      

© 1998-2018