Dataset for CDS BBC3 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q9BXH1_BBC3-04      atgaaatttg--------------------------------------------------
Q9BXH1_BBC3-05      atgaaatttg--------------------------------------------------
Q9BXH1_BBC3-03      atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttcc
B4DQK3_BBC3-01      ------------------------------------------------------------
Q9BXH1_BBC3-06      ------------------------------------------------------------
                                                                                

Q9BXH1_BBC3-04      ------------------------------------------------------------
Q9BXH1_BBC3-05      ------------------------------------------------------------
Q9BXH1_BBC3-03      acgacgtgggtcccctgccagatttgtggccccagggagcgccatggcccgcgcacgcca
B4DQK3_BBC3-01      -------------------------atggccccagggagcgccatggcccgcgcacgcca
Q9BXH1_BBC3-06      -------------------------------------------atggcccgcgcacgcca
                                                                                

Q9BXH1_BBC3-04      ----------------------gcatggggtctgcccaggcatgtcc-------------
Q9BXH1_BBC3-05      ----------------------gcatggggtctgcccaggcatgtcc-------------
Q9BXH1_BBC3-03      ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttccc
B4DQK3_BBC3-01      ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttccc
Q9BXH1_BBC3-06      ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttccc
                                          * *  *** *** ** *  * * **             

Q9BXH1_BBC3-04      ------atgccaggtgcccagg----------gctgcttccacga---------------
Q9BXH1_BBC3-05      ------atgccaggtgcccagg----------gctgcttccacga---------------
Q9BXH1_BBC3-03      gctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
B4DQK3_BBC3-01      gctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
Q9BXH1_BBC3-06      gctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
                            *** *******  *          ** ** **  ***               

Q9BXH1_BBC3-04      ------------------------------------------------------------
Q9BXH1_BBC3-05      ------------------------------------------------------------
Q9BXH1_BBC3-03      cgcccccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacc
B4DQK3_BBC3-01      cgcccccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacc
Q9BXH1_BBC3-06      cgcccccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacc
                                                                                

Q9BXH1_BBC3-04      ------------------------------------cgtgggtcccct--gccagatttg
Q9BXH1_BBC3-05      ------------------------------------cgtgggtcccct--gccagatttg
Q9BXH1_BBC3-03      cgccgtcaccgccgccctggggggttcccgctggcctgggggtccccgcagccggccccg
B4DQK3_BBC3-01      cgccgtcaccgccgccctggggggttcccgctggcctgggggtccccgcagccggccccg
Q9BXH1_BBC3-06      cgccgtcaccgccgccctggggggttcccgctggcctgggggtccccgcagccggccccg
                                                         * ********   *** *    *

Q9BXH1_BBC3-04      ------------------------------------------------------------
Q9BXH1_BBC3-05      ---------------tggtcctcagccctcgctctcgctggcggagcagcacctggagtc
Q9BXH1_BBC3-03      aggcccgcgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtc
B4DQK3_BBC3-01      aggcccgcgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtc
Q9BXH1_BBC3-06      aggcccgcgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtc
                                                                                

Q9BXH1_BBC3-04      ------------------------------------------------------------
Q9BXH1_BBC3-05      gcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagt
Q9BXH1_BBC3-03      gcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagt
B4DQK3_BBC3-01      gcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagt
Q9BXH1_BBC3-06      gcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagt
                                                                                

Q9BXH1_BBC3-04      ------------------------------------------------------------
Q9BXH1_BBC3-05      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcgga
Q9BXH1_BBC3-03      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcgga
B4DQK3_BBC3-01      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcgga
Q9BXH1_BBC3-06      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcgga
                                                                                

Q9BXH1_BBC3-04      --------------------------tgagacaagaggagcagcagcggcaccgcccctc
Q9BXH1_BBC3-05      cgacctcaacgcacagtacgagcggcggagacaagaggagcagcagcggcaccgcccctc
Q9BXH1_BBC3-03      cgacctcaacgcacagtacgagcggcggagacaagaggagcagcagcggcaccgcccctc
B4DQK3_BBC3-01      cgacctcaacgcacagtacgagcggcggagacaagaggagcagcagcggcaccgcccctc
Q9BXH1_BBC3-06      cgacctcaacgcacagtacgagcggcggagacaagaggagcagcagcggcaccgcccctc
                                               *********************************

Q9BXH1_BBC3-04      accctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacag
Q9BXH1_BBC3-05      accctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacag
Q9BXH1_BBC3-03      accctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacag
B4DQK3_BBC3-01      accctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacag
Q9BXH1_BBC3-06      accctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacag
                    ************************************************************

Q9BXH1_BBC3-04      agcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
Q9BXH1_BBC3-05      agcccccgagatggagcccaattag-----------------------------------
Q9BXH1_BBC3-03      agcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
B4DQK3_BBC3-01      agcccccgagatggagcccaattag-----------------------------------
Q9BXH1_BBC3-06      agcccccgagatggagcccaattag-----------------------------------
                    *************************                                   

Q9BXH1_BBC3-04      gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcacc
Q9BXH1_BBC3-05      ------------------------------------------------------------
Q9BXH1_BBC3-03      gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcacc
B4DQK3_BBC3-01      ------------------------------------------------------------
Q9BXH1_BBC3-06      ------------------------------------------------------------
                                                                                

Q9BXH1_BBC3-04      atgtag
Q9BXH1_BBC3-05      ------
Q9BXH1_BBC3-03      atgtag
B4DQK3_BBC3-01      ------
Q9BXH1_BBC3-06      ------
                          

© 1998-2019