Dataset for CDS BAD of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q92934_BAD-03      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagagg
Q92934_BAD-04      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagagg
Q92934_BAD-02      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagagg
Q92934_BAD-01      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagagg
B4DZQ9_BAD-01      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagagg
                   ************************************************************

Q92934_BAD-03      ggcctgggccccagccccgcaggggacgggccctcaggctccggcaagcatcatcgccag
Q92934_BAD-04      ggcctgggccccagccccgcaggggacgggccctcaggctccggcaagcatcatcgccag
Q92934_BAD-02      ggcctgggccccagccccgcaggggacgggccctcaggctccggcaagcatcatcgccag
Q92934_BAD-01      ggcctgggccccagccccgcaggggacgggccctcaggctccggcaagcatcatcgccag
B4DZQ9_BAD-01      ggcctgggccccagccccgcaggggacgggccctcaggctccggcaagcatcatcgccag
                   ************************************************************

Q92934_BAD-03      gccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccat
Q92934_BAD-04      gccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccat
Q92934_BAD-02      gccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccat
Q92934_BAD-01      gccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccat
B4DZQ9_BAD-01      gccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccat
                   ************************************************************

Q92934_BAD-03      catggagaagggacttcctcgccc------------------------------------
Q92934_BAD-04      catggagggagaacttcgtattctccttcttgggaatctgaggactctgaaaatcccagt
Q92934_BAD-02      catg--------------------------------------------------------
Q92934_BAD-01      catg--------------------------------------------------------
B4DZQ9_BAD-01      catg--------------------------------------------------------
                   ****                                                        

Q92934_BAD-03      ------------------------------------------------------------
Q92934_BAD-04      gcagggatgctcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcc
Q92934_BAD-02      ------------------------------------------------------------
Q92934_BAD-01      ------------------------------------------------------------
B4DZQ9_BAD-01      ------------------------------------------------------------
                                                                               

Q92934_BAD-03      ------------------------gaagagcgcgggc-acagcaacgcagatgcggcaaa
Q92934_BAD-04      caacacgcagagaatgtaaagctagaggcgctggggctgtggagatccggagtcgccaca
Q92934_BAD-02      ------------------------gaggcgctggggctgtggagatccggagtcgccaca
Q92934_BAD-01      ------------------------gaggcgctggggctgtggagatccggagtcgccaca
B4DZQ9_BAD-01      ------------------------gaggcgctggggctgtggagatccggagtcgccaca
                                           ** * **  ****    *  *  * **  ** ** *

Q92934_BAD-03      gctccagct------ggacgcgagtcttccagtcctggtgggatcggaacttgggcaggg
Q92934_BAD-04      gctcctaccccgcggggacggaggacgac-------gaagggatggg----------gga
Q92934_BAD-02      gctcctaccccgcggggacggaggacgac-------gaagggatggg----------gga
Q92934_BAD-01      gctcctaccccgcggggacggaggacgac-------gaagggatggg----------gga
B4DZQ9_BAD-01      gctcctaccccgcggggacggaggacgac-------gaagggatggg----------gga
                   *****  *       *****   * *  *       *  ***** **          ** 

Q92934_BAD-03      gaagctccgccccctcc-cagtgaccttcgctccacatcccgaaactccacccgttccca
Q92934_BAD-04      ggagcccagcccctttcggggccgctcgcgctcggcgccccccaac--------------
Q92934_BAD-02      ggagcccagcccctttcggggccgctcgcgctcggcgccccccaac--------------
Q92934_BAD-01      ggagcccagcccctttcggggccgctcgcgctcggcgccccccaac--------------
B4DZQ9_BAD-01      ggagcccagcccctttcggggccgttcgcgctcggcgccccccaac--------------
                   * *** * ***** * *   *       *****  *  ***  ***              

Q92934_BAD-03      ctgccctgggcagc-catcttgaatatgggcggaagtacttccctcaggcctatgcaaaa
Q92934_BAD-04      ---ctctgggcagcacagc---gctatggccgcgag-------ctccggaggatga----
Q92934_BAD-02      ---ctctgggcagcacagc---gctatggccgcgag-------ctccggaggatgagtga
Q92934_BAD-01      ---ctctgggcagcacagc---gctatggccgcgag-------ctccggaggatgagtga
B4DZQ9_BAD-01      ---ctctgggcagcacagc---gctatggccgcgag-------ctccggaggatgagtga
                      * ********* ** *     ***** **  **       *** **   ***     

Q92934_BAD-03      agaggatccgtgct------------gtctcctttggagggagggc----------tgac
Q92934_BAD-04      ------------------------------------------------------------
Q92934_BAD-02      cgagtttgtggactcctttaagaagggacttcctcgcccgaagagcgcgggcacagcaac
Q92934_BAD-01      cgagtttgtggactcctttaagaagggacttcctcgcccgaagagcgcgggcacagcaac
B4DZQ9_BAD-01      cgagtttgtggactcctttaagaagggacttcctcgcccgaagagcgcgggcacagcaac
                                                                               

Q92934_BAD-03      ccagattc----------------------------------------------------
Q92934_BAD-04      ------------------------------------------------------------
Q92934_BAD-02      gcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaactt
Q92934_BAD-01      gcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaactt
B4DZQ9_BAD-01      gcagatgcggcaaagcccca---------------------------------ggcgcct
                                                                               

Q92934_BAD-03      --------------ccttccggtgcgtgtga
Q92934_BAD-04      -------------------------------
Q92934_BAD-02      gggcaggggaagctccgccccctcccagtga
Q92934_BAD-01      gggcaggggaagctccgccccctcccagtga
B4DZQ9_BAD-01      gcgc------------------------taa
                                                  

© 1998-2018