Dataset for CDS BMF of organism Hippocampus comes

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q2YCX7_BMF-01      atggaggatgaggaggatgatgtgtttgagccagacccccactgctggcg
A0A3Q2YCX7_BMF-02      atggaggatgaggaggatgatgtgtttgagccagacccccactgctggcg
                       **************************************************

A0A3Q2YCX7_BMF-01      caccacattcaaggagataaagtgtgaggagcgggcaacacagacacctg
A0A3Q2YCX7_BMF-02      caccacattcaaggagataaagtgtgaggagcgggcaacacagacacctg
                       **************************************************

A0A3Q2YCX7_BMF-01      gccccgtcccggcatcaaacaacggcatgctgccctgtggagtcgcagag
A0A3Q2YCX7_BMF-02      gccccgtcccggcatcaaacaacggcatgctgccctgtggagtcgcagag
                       **************************************************

A0A3Q2YCX7_BMF-01      gagccaagaccactcttctacggtaacgcaggttttcgattgcacttccc
A0A3Q2YCX7_BMF-02      gagccaagaccactcttctacggtaacgcaggttttcgattgcacttccc
                       **************************************************

A0A3Q2YCX7_BMF-01      ggcccactttgaacttgttggtgaacaggaggagcgactgcaagaaagcg
A0A3Q2YCX7_BMF-02      ggcccactttgaacttgttggtgaacaggaggagcgactgcaagaaagcg
                       **************************************************

A0A3Q2YCX7_BMF-01      acgacggaatggagcagcaactccagcagcagcagcagcagcagcccgtg
A0A3Q2YCX7_BMF-02      acgacggaatggagcagcaactccagcagcagcagcagcagcagcccgtg
                       **************************************************

A0A3Q2YCX7_BMF-01      gcacgcagcatagaggcctgcgtcggtcagaaactccagctgattggaga
A0A3Q2YCX7_BMF-02      gcacgcagcatagaggcctgcgtcggtcagaaactccagctgattggaga
                       **************************************************

A0A3Q2YCX7_BMF-01      ccagtttcatcgggaacacttacagctggtgagcaggaatcaacacaagc
A0A3Q2YCX7_BMF-02      ccagtttcatcgggaacacttacagctggtgagcaggaatcaacacaagc
                       **************************************************

A0A3Q2YCX7_BMF-01      acaaataa
A0A3Q2YCX7_BMF-02      acaaataa
                       ********

© 1998-2019