Dataset for CDS classical BH3-containing proteins of organism Haplochromis burtoni

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3C5V2_BMF-01      atggacga-----tgagga----ggacgatgtgtttgagcca--------
A0A3Q3C680_BAD-01      atggctgcaaacttcaaaatttcagacagtgattcagaggcatcagagga
                       ****  *      * *  *     ***  **  *  *** **        

A0A3Q3C5V2_BMF-01      --------------aaagccaactgttggcgcaccacattcagggagata
A0A3Q3C680_BAD-01      ggtaggggaagaagaaaaccaacagtcagcaggacaagctcaagaaagca
                                     *** ***** **  **    **   *** * *   *

A0A3Q3C5V2_BMF-01      aagtgtgaacatcgaggcacacagacacccggtcctgccctggtacc-aa
A0A3Q3C680_BAD-01      ag----------------ccccagacgctt--tcccttcctgtaatcaaa
                       *                  * ***** *    ***   ****  * * **

A0A3Q3C5V2_BMF-01      acaacggcatgctgccctgtggagtcgcagag-gagcccaga---ccact
A0A3Q3C680_BAD-01      acgacagc-tgctg------gaaggctcagggtgaactcagagtcccaca
                       ** ** ** *****      * ** * *** * ** * ****   **** 

A0A3Q3C5V2_BMF-01      cttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagc
A0A3Q3C680_BAD-01      cttc----------------ctcaattg-----ccagggatgag--gagc
                       ****                 ** ****     ** ** * *    ****

A0A3Q3C5V2_BMF-01      tcgt------cgggga-----------------tcacagagcgagtcgac
A0A3Q3C680_BAD-01      tcatggctagaggggaggatgaggtctgtactcccacagagggagac-cc
                       ** *       *****                  ******* *** *  *

A0A3Q3C5V2_BMF-01      aaggaagcacggagcagcaaaacagcatggagcgcctgccccgccagcga
A0A3Q3C680_BAD-01      attcaggcgaaggtca--aagtcagctc----cccctgctctgtgggctg
                       *   * **   *  **  **  ****      * ***** * *   **  

A0A3Q3C5V2_BMF-01      cc------cgcggctcgcagcgtggaggcctgcattggacagaaactcca
A0A3Q3C680_BAD-01      ccaagaagtacggcaggcagcttcgacgaatgagt--gacgagtttgaca
                       **        ****  ***** * ** *  **  *  ***        **

A0A3Q3C5V2_BMF-01      gctcat---------aggagaccagtttcactgggaacgcctgcaactgt
A0A3Q3C680_BAD-01      gcttactagataaaggggagatgaaggtcaa-----------gaagctgc
                       *** *           *****  *   ***            * * *** 

A0A3Q3C5V2_BMF-01      atca--ccgaaaccaaaggaa-----------------ccaggggccgat
A0A3Q3C680_BAD-01      accactctaaaacctggtggagctatctctttagtcaccaagagactgaa
                       * **  *  *****    * *                 * ** * * ** 

A0A3Q3C5V2_BMF-01      gtggtggcgcctggccgcggccattctcagccttctgtttgatagggggt
A0A3Q3C680_BAD-01      ggagaga---------acaaccatctt------------------gaaaa
                       *  * *           *  ****  *                  *    

A0A3Q3C5V2_BMF-01      tcatagccggcggagggggtggaggacggaggtga
A0A3Q3C680_BAD-01      ccacaaccaacgcactgagtaa-------------
                        ** * **  ** *  * **               

© 1998-2019