Dataset for CDS PMAIP1 of organism Gorilla gorilla gorilla

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I2YVQ5_PMAIP1-      atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggc
A0A2I2YVQ5_PMAIP1-      atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggc
                        **************************************************

A0A2I2YVQ5_PMAIP1-      tccagcaggaccggcgggtacggcgagggaccaagccggctttgggattg
A0A2I2YVQ5_PMAIP1-      tccagcag------------------------------------------
                        ********                                          

A0A2I2YVQ5_PMAIP1-      agatgcagctgcgtttcaccaggggcaaaaagctcctttcctcctcgcca
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A2I2YVQ5_PMAIP1-      cttgcccttccccggggccacgaggaacaagtgcaagtagctggaagtcg
A0A2I2YVQ5_PMAIP1-      --------------------------------------agctggaagtcg
                                                              ************

A0A2I2YVQ5_PMAIP1-      agtgtgctactcaactcaggagatttggagacaaactgaacttccggcag
A0A2I2YVQ5_PMAIP1-      agtgtgctactcaactcaggagatttggagacaaactgaacttccggcag
                        **************************************************

A0A2I2YVQ5_PMAIP1-      aaacttctgaatctgatatccaaactcttctgctcaggaacctgactgca
A0A2I2YVQ5_PMAIP1-      aaacttctgaatctgatatccaaactcttctgctcaggaacctga-----
                        *********************************************     

A0A2I2YVQ5_PMAIP1-      tcaaaaacttgcatgaggggactccttcaaaagagttttctcaggaggtg
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A2I2YVQ5_PMAIP1-      cacatttcatcagtttgaagaaagactgcattgtaattgggaggaatgtg
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A2I2YVQ5_PMAIP1-      aaggtgcattcatgggtgcccttggaaacggaagatggaatacatcaaag
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A2I2YVQ5_PMAIP1-      tga
A0A2I2YVQ5_PMAIP1-      ---
                           

© 1998-2018