Dataset for CDS classical BH3-containing proteins of organism Gorilla gorilla gorilla

[Download (right click)] [Edit] [Sequences] [Repertoires]

20 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3QCT2_BIK-01           atgtctgaagtaagacccctctccagagacatcttgatggagaccctcct
G3QTJ6_HRK-01           atgt----------------------------------------------
A0A2I2YVQ5_PMAIP1-      atg-----------------------------------------------
A0A2I2YVQ5_PMAIP1-      atg-----------------------------------------------
A0A2I2YQ13_BCL2L11      atggcaaagcaaccttc---------------------------------
A0A2I2YQ13_BCL2L11      atggcaaagcaaccttc---------------------------------
A0A2I2YQ13_BCL2L11      atggcaaagcaaccttc---------------------------------
A0A2I2YQ13_BCL2L11      atggcaaagcaaccttc---------------------------------
A0A2I2YQ13_BCL2L11      atggcaaagcaaccttc---------------------------------
A0A2I2YQ13_BCL2L11      atggcaaagcaaccttc---------------------------------
A0A2I2YQ13_BCL2L11      atggcaaagcaaccttc---------------------------------
A0A2I2YQ13_BCL2L11      atggcaaagcaaccttc---------------------------------
A0A2I2YQ13_BCL2L11      atggcaaagcaaccttc---------------------------------
A0A2I2YQ13_BCL2L11      atggcaaagcaaccttc---------------------------------
G3QIN5_BMF-02           atgg----------agc---------------------------------
G3QIN5_BMF-01           atgg----------agc---------------------------------
A0A2I2Z8C7_BAD-03       atgt----------tcc---------------------------------
A0A2I2Z8C7_BAD-04       atgt----------tcc---------------------------------
A0A2I2Z8C7_BAD-02       atgt----------tcc---------------------------------
A0A2I2Z8C7_BAD-01       atgt----------tcc---------------------------------
                        ***                                               

G3QCT2_BIK-01           gtatgagcagctcctggaacccccgaccatggaggttcttggcgtgactg
G3QTJ6_HRK-01           ---------------------------------------------gcccg
A0A2I2YVQ5_PMAIP1-      -------------------------------------cctgggaagaagg
A0A2I2YVQ5_PMAIP1-      -------------------------------------cctgggaagaagg
A0A2I2YQ13_BCL2L11      --------------------------tgatgtaagt-tctga---gtgtg
A0A2I2YQ13_BCL2L11      --------------------------tgatgtaagt-tctga---gtgtg
A0A2I2YQ13_BCL2L11      --------------------------tgatgtaagt-tctga---gtgtg
A0A2I2YQ13_BCL2L11      --------------------------tgatgtaagt-tctga---gtgtg
A0A2I2YQ13_BCL2L11      --------------------------tgatgtaagt-tctga---gtgtg
A0A2I2YQ13_BCL2L11      --------------------------tgatgtaagt-tctga---gtgtg
A0A2I2YQ13_BCL2L11      --------------------------tgatgtaagt-tctga---gtgtg
A0A2I2YQ13_BCL2L11      --------------------------tgatgtaagt-tctga---gtgtg
A0A2I2YQ13_BCL2L11      --------------------------tgatgtaagt-tctga---gtgtg
A0A2I2YQ13_BCL2L11      --------------------------tgatgtaagt-tctga---gtgtg
G3QIN5_BMF-02           --------------------------c-atctcagtgtgtg----gag-g
G3QIN5_BMF-01           --------------------------c-atctcagtgtgtg----gag-g
A0A2I2Z8C7_BAD-03       --------------------------agatcccagagtttgagccgagtg
A0A2I2Z8C7_BAD-04       --------------------------agatcccagagtttgagccgagtg
A0A2I2Z8C7_BAD-02       --------------------------agatcccagagtttgagccgagtg
A0A2I2Z8C7_BAD-01       --------------------------agatcccagagtttgagccgagtg
                                                                     *   *

G3QCT2_BIK-01           actctgaagaggacctggaccctatggaggacttcgattctttggagtgc
G3QTJ6_HRK-01           tgc----------------------------cccctgcac-------cgc
A0A2I2YVQ5_PMAIP1-      cgcgcaaga--------------acgctcaaccg-agccc-------cgc
A0A2I2YVQ5_PMAIP1-      cgcgcaaga--------------acgctcaaccg-agccc-------cgc
A0A2I2YQ13_BCL2L11      accgagaag--------------gtagacaattgcagc-c-------tgc
A0A2I2YQ13_BCL2L11      accgagaag--------------gtagacaattgcagc-c-------tgc
A0A2I2YQ13_BCL2L11      accgagaag--------------gtagacaattgcagc-c-------tgc
A0A2I2YQ13_BCL2L11      accgagaag--------------gtagacaattgcagc-c-------tgc
A0A2I2YQ13_BCL2L11      accgagaag--------------gtagacaattgcagc-c-------tgc
A0A2I2YQ13_BCL2L11      accgagaag--------------gtagacaattgcagc-c-------tgc
A0A2I2YQ13_BCL2L11      accgagaag--------------gtagacaattgcagc-c-------tgc
A0A2I2YQ13_BCL2L11      accgagaag--------------gtagacaattgcagc-c-------tgc
A0A2I2YQ13_BCL2L11      accgagaag--------------gtagacaattgcagc-c-------tgc
A0A2I2YQ13_BCL2L11      accgagaag--------------gtagacaattgcagc-c-------tgc
G3QIN5_BMF-02           agctggagg--------------atgatgtgttccaacca-------gag
G3QIN5_BMF-01           agctggagg--------------atgatgtgttccaacca-------gag
A0A2I2Z8C7_BAD-03       agcaggaag--------------a-------ctccagctc-------tgc
A0A2I2Z8C7_BAD-04       agcaggaag--------------a-------ctccagctc-------tgc
A0A2I2Z8C7_BAD-02       agcaggaag--------------a-------ctccagctc-------tgc
A0A2I2Z8C7_BAD-01       agcaggaag--------------a-------ctccagctc-------tgc
                                                                          

G3QCT2_BIK-01           atggagggcagtgacgcgttggccctgcggctggcc-------------t
G3QTJ6_HRK-01           ggccgcggcccccc------ggccgtgtgcgcctgcagcgcggg-----t
A0A2I2YVQ5_PMAIP1-      g------------------------cgggctccagcaggaccggcgggta
A0A2I2YVQ5_PMAIP1-      g------------------------cgggctccagcag------------
A0A2I2YQ13_BCL2L11      ggagaggcctccccagctcagacctggggcccctac-------------c
A0A2I2YQ13_BCL2L11      ggagaggcctccccagctcagacctggggcccctac-------------c
A0A2I2YQ13_BCL2L11      ggagaggcctccccagctcagacctggggcccctac-------------c
A0A2I2YQ13_BCL2L11      ggagaggcctccccagctcagacctggggcccctac-------------c
A0A2I2YQ13_BCL2L11      ggagaggcctccccagctcagacctggggcccctac-------------c
A0A2I2YQ13_BCL2L11      ggagaggcctccccagctcagacctggggcccctac-------------c
A0A2I2YQ13_BCL2L11      ggagaggcctccccagctcagacctggggcccctac-------------c
A0A2I2YQ13_BCL2L11      ggagaggcctccccagctcagacctggggcccctac-------------c
A0A2I2YQ13_BCL2L11      ggagaggcctccccagctcagacctggggcccctac-------------c
A0A2I2YQ13_BCL2L11      ggagaggcctccccagctcagacctggggcccctac-------------c
G3QIN5_BMF-02           gatggg--------------gagccggtgacccaac-------------c
G3QIN5_BMF-01           gatggg--------------gagccggtgacccaac-------------c
A0A2I2Z8C7_BAD-03       agagag--------------gggcctgggccccagc-------------c
A0A2I2Z8C7_BAD-04       agagag--------------gggcctgggccccagc-------------c
A0A2I2Z8C7_BAD-02       agagag--------------gggcctgggccccagc-------------c
A0A2I2Z8C7_BAD-01       agagag--------------gggcctgggccccagc-------------c
                                                  * *      *              

G3QCT2_BIK-01           gcatcggggatgagatggacgtgagcctc-------------------ag
G3QTJ6_HRK-01           cgcctggggctg----------cgctcgt---------------------
A0A2I2YVQ5_PMAIP1-      cggcgagggacc----------aagccggctttgggattgagatgcagct
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YQ13_BCL2L11      tccctacagaca----------gagccac-------------------aa
A0A2I2YQ13_BCL2L11      tccctacagaca----------gagccac-------------------aa
A0A2I2YQ13_BCL2L11      tccctacagaca----------gagccac-------------------aa
A0A2I2YQ13_BCL2L11      tccctacagaca----------gagccac-------------------aa
A0A2I2YQ13_BCL2L11      tccctacagaca----------gagccac-------------------aa
A0A2I2YQ13_BCL2L11      tccctacagaca----------gagccac-------------------a-
A0A2I2YQ13_BCL2L11      tccctacagaca----------gagccac-------------------aa
A0A2I2YQ13_BCL2L11      tccctacagaca----------gagccac-------------------aa
A0A2I2YQ13_BCL2L11      tccctacagaca----------gagccac-------------------aa
A0A2I2YQ13_BCL2L11      tccctacagaca----------gagccac-------------------aa
G3QIN5_BMF-02           c----gggagct----------tgctctctgctgacctgtttgcccagag
G3QIN5_BMF-01           c----gggagct----------tgctctctgctgacctgtttgcccagag
A0A2I2Z8C7_BAD-03       ccgcaggggacg----------ggccctc-------------------ag
A0A2I2Z8C7_BAD-04       ccgcaggggacg----------ggccctc-------------------ag
A0A2I2Z8C7_BAD-02       ccgcaggggacg----------ggccctc-------------------ag
A0A2I2Z8C7_BAD-01       ccgcaggggacg----------ggccctc-------------------ag
                                                                          

G3QCT2_BIK-01           g-------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      g-------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YQ13_BCL2L11      g-------------------------------------------------
A0A2I2YQ13_BCL2L11      g-------------------------------------------------
A0A2I2YQ13_BCL2L11      g-------------------------------------------------
A0A2I2YQ13_BCL2L11      ggtaatcctgaaggcaatcacggaggtgaaggggacagctgcccccacgg
A0A2I2YQ13_BCL2L11      ggtaatcctgaaggcaatcacggaggtgaaggggacagctgcccccacgg
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      ggtaatcctgaaggcaatcacggaggtgaaggggacagctgcccccacgg
A0A2I2YQ13_BCL2L11      ggtaatcctgaaggcaatcacggaggtgaaggggacagctgcccccacgg
A0A2I2YQ13_BCL2L11      ggtaatcctgaaggcaatcacggaggtgaaggggacagctgcccccacgg
A0A2I2YQ13_BCL2L11      ggtaatcctgaaggcaatcacggaggtgaaggggacagctgcccccacgg
G3QIN5_BMF-02           c-------------------------------------------------
G3QIN5_BMF-01           c-------------------------------------------------
A0A2I2Z8C7_BAD-03       g-------------------------------------------------
A0A2I2Z8C7_BAD-04       g-------------------------------------------------
A0A2I2Z8C7_BAD-02       g-------------------------------------------------
A0A2I2Z8C7_BAD-01       g-------------------------------------------------
                                                                          

G3QCT2_BIK-01           ----------------------gccccgcgcctggccc-agctctcc---
G3QTJ6_HRK-01           ---------ccgccgcgcagctcaccgccgcccggctcaa----------
A0A2I2YVQ5_PMAIP1-      ------------cgtttcac--caggggcaaaaagctcctttcctcct--
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      cagccctcagggcccgctgg--ccccaccggccagccctggcccttttgc
A0A2I2YQ13_BCL2L11      cagccctcagggcccgctgg--ccccaccggccagccctggcccttttgc
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      cagccctcagggcccgctgg--ccccaccggccagccctggcccttttgc
A0A2I2YQ13_BCL2L11      cagccctcagggcccgctgg--ccccaccggccagccctggcccttttgc
A0A2I2YQ13_BCL2L11      cagccctcagggcccgctgg--ccccaccggccagccctggcccttttgc
A0A2I2YQ13_BCL2L11      cagccctcagggcccgctgg--ccccaccggccagccctggcccttttgc
G3QIN5_BMF-02           ---------ctactggactg--ccccctcagccgacttcagctcttc---
G3QIN5_BMF-01           ---------ctactggactg--ccccctcagccgacttcagctcttc---
A0A2I2Z8C7_BAD-03       ---------ct-ccggcaag--catcatcgccaggccccaggcctcct--
A0A2I2Z8C7_BAD-04       ---------ct-ccggcaag--catcatcgccaggccccaggcctcct--
A0A2I2Z8C7_BAD-02       ---------ct-ccggcaag--catcatcgccaggccccaggcctcct--
A0A2I2Z8C7_BAD-01       ---------ct-ccggcaag--catcatcgccaggccccaggcctcct--
                                                                          

G3QCT2_BIK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      taccagatccccgcttttcatctttatgagaagatcctccctgctgtctc
A0A2I2YQ13_BCL2L11      taccagatccccgcttttcatctttatgagaagatcctccctgctgtctc
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      taccagatccccgcttttcatctttatgagaagatcctccctgctgtctc
A0A2I2YQ13_BCL2L11      taccagatccccgcttttcatctttatgagaagatcctccctgctgtctc
A0A2I2YQ13_BCL2L11      taccagatccccgcttttcatctttatgagaagatcctccctgctgtctc
A0A2I2YQ13_BCL2L11      taccagatccccgcttttcatctttatgagaagatcctccctgctgtctc
G3QIN5_BMF-02           --------------------------------------------------
G3QIN5_BMF-01           --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
                                                                          

G3QCT2_BIK-01           ---------------------------------gaggtggccatgcacag
G3QTJ6_HRK-01           --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      ---------------------------------------cgccacttgcc
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YQ13_BCL2L11      ---------------------------------acaggagcccagcaccc
A0A2I2YQ13_BCL2L11      ---------------------------------acaggagcccagcaccc
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      gatcctccagtgggtatttctcttttgacacagacaggagcccagcaccc
A0A2I2YQ13_BCL2L11      gatcctccagtgggtatttctcttttgacacagacaggagcccagcaccc
A0A2I2YQ13_BCL2L11      -------------------------------agacaggagcccagcaccc
A0A2I2YQ13_BCL2L11      gatcctccagtgggtatttctcttttgacacagacaggagcccagcaccc
A0A2I2YQ13_BCL2L11      gatcctccagtgggtatttctcttttgacacagacaggagcccagcaccc
A0A2I2YQ13_BCL2L11      gatcctccagtgggtatttctcttttgacacagacaggagcccagcaccc
A0A2I2YQ13_BCL2L11      gatcctccagtgggtatttctcttttgacacagacaggagcccagcaccc
G3QIN5_BMF-02           -----------------------------------------cctctcacc
G3QIN5_BMF-01           -----------------------------------------cctctcacc
A0A2I2Z8C7_BAD-03       ---------------------------------gtgggacgccagtcacc
A0A2I2Z8C7_BAD-04       ---------------------------------gtgggacgccagtcacc
A0A2I2Z8C7_BAD-02       ---------------------------------gtgggacgccagtcacc
A0A2I2Z8C7_BAD-01       ---------------------------------gtgggacgccagtcacc
                                                                          

G3QCT2_BIK-01           cctgggtctggctttcatctacgaccagaccgaggac-------------
G3QTJ6_HRK-01           ---------ggcgctaggcgacgagctgcaccagc---------------
A0A2I2YVQ5_PMAIP1-      cttccccggggccacgaggaacaagtgcaagtagctg-------------
A0A2I2YVQ5_PMAIP1-      --------------------------------agctg-------------
A0A2I2YQ13_BCL2L11      atgagttgtgac---------aaatcaacacaaaccc-------------
A0A2I2YQ13_BCL2L11      atgagttgtgac---------aaatcaacacaaaccc-------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      atgagttgtgac---------aaatcaacacaaaccc-------------
A0A2I2YQ13_BCL2L11      atgagttgtgac---------aaatcaacacaaaccc-------------
A0A2I2YQ13_BCL2L11      atgagttgtgac---------aaatcaacacaaaccc-------------
A0A2I2YQ13_BCL2L11      atgagttgtgac---------aaatcaacacaaaccc-------------
A0A2I2YQ13_BCL2L11      atgagttgtgac---------aaatcaacacaaaccc-------------
A0A2I2YQ13_BCL2L11      atgagttgtgac---------aaatcaacacaaaccc-------------
A0A2I2YQ13_BCL2L11      atgagttgtgac---------aaatcaacacaaaccc-------------
G3QIN5_BMF-02           cactgctgtggccctggccttcgacc--caccagcca-------------
G3QIN5_BMF-01           cactgctgtggccctggccttcgacc--caccagcca-------------
A0A2I2Z8C7_BAD-03       agcaggagcagc---------caaccagcagcagccatcatggagaaggg
A0A2I2Z8C7_BAD-04       agcaggagcagc---------caaccagcagcagccatcatggagggaga
A0A2I2Z8C7_BAD-02       agcaggagcagc---------caaccagcagcagccatcatg--------
A0A2I2Z8C7_BAD-01       agcaggagcagc---------caaccagcagcagccatcatg--------
                                                                          

G3QCT2_BIK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
G3QIN5_BMF-01           --------------------------------------------------
A0A2I2Z8C7_BAD-03       acttcct-------------------------------------------
A0A2I2Z8C7_BAD-04       acttcgtattctccttcttgggaatctgaggactctgaaaatcccagtgc
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
                                                                          

G3QCT2_BIK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
G3QIN5_BMF-01           --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       agggatgctcgcggaagcatcagcagggatgtccgccccagccgctgact
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
                                                                          

G3QCT2_BIK-01           ---------------------------------atcagggatgttcttag
G3QTJ6_HRK-01           --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      -------------------------------------------------g
A0A2I2YVQ5_PMAIP1-      -------------------------------------------------g
A0A2I2YQ13_BCL2L11      -------------------------------------------------c
A0A2I2YQ13_BCL2L11      -------------------------------------------------c
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      -------------------------------------------------c
A0A2I2YQ13_BCL2L11      -------------------------------------------------c
A0A2I2YQ13_BCL2L11      -------------------------------------------------c
A0A2I2YQ13_BCL2L11      -------------------------------------------------c
A0A2I2YQ13_BCL2L11      -------------------------------------------------c
A0A2I2YQ13_BCL2L11      -------------------------------------------------c
A0A2I2YQ13_BCL2L11      -------------------------------------------------c
G3QIN5_BMF-02           ---------------------------------ggaagacaaagctaccc
G3QIN5_BMF-01           ---------------------------------ggaagacaaagctaccc
A0A2I2Z8C7_BAD-03       -----------cgcccgaagagcgcaggcacagcaacgcagatgcggcaa
A0A2I2Z8C7_BAD-04       cagaagcccaacacgcagagaatgtaaagctagaggcgctggggctgtgg
A0A2I2Z8C7_BAD-02       --------------------------------gaggcgctggggctgtgg
A0A2I2Z8C7_BAD-01       --------------------------------gaggcgctggggctgtgg
                                                                          

G3QCT2_BIK-01           aagtttcatggacggtttcaccacccttaaggagaacataatgaggttct
G3QTJ6_HRK-01           --gcaccatgtggcggcgccgcgcgcggagccggagggcgccggcgcccg
A0A2I2YVQ5_PMAIP1-      aagtcgagtgtgct----------actcaactcaggagatttggagacaa
A0A2I2YVQ5_PMAIP1-      aagtcgagtgtgct----------actcaactcaggagatttggagacaa
A0A2I2YQ13_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtca
A0A2I2YQ13_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg-----a
A0A2I2YQ13_BCL2L11      --------------------------------------------cttcca
A0A2I2YQ13_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtt----
A0A2I2YQ13_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaat--------
A0A2I2YQ13_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2I2YQ13_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2I2YQ13_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2I2YQ13_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2I2YQ13_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggc-----
G3QIN5_BMF-02           agaccctc--agcccagcctc---ccccagccaaggtgtcatgctgcctt
G3QIN5_BMF-01           agaccctc--agcccagcctc---ccccagccaaggtgtcatgctgcctt
A0A2I2Z8C7_BAD-03       agctccagctggacgcgagtc---ttccagtcctggtgggat------cg
A0A2I2Z8C7_BAD-04       agatccgg--agtcgccacag---ctcctaccccgcggggacggaggacg
A0A2I2Z8C7_BAD-02       agatccgg--agtcgccacag---ctcctaccccgcggggacggaggacg
A0A2I2Z8C7_BAD-01       agatccgg--agtcgccacag---ctcctaccccgcggggacggaggacg
                                                                          

G3QCT2_BIK-01           --------------ggagatccccgaaccccgggtcctgggtgtcccgc-
G3QTJ6_HRK-01           gcgcg---------------ctccccacctactggccttggctgtgcgc-
A0A2I2YVQ5_PMAIP1-      actgaacttccggcagaaacttctgaatctgatatccaaactcttctgc-
A0A2I2YVQ5_PMAIP1-      actgaacttccggcagaaacttctgaatctgatatccaaactcttctgc-
A0A2I2YQ13_BCL2L11      tcctagaggatataggtgatctttcactgtggtttggatttatatttac-
A0A2I2YQ13_BCL2L11      t------gactccgctggatcct---------------------------
A0A2I2YQ13_BCL2L11      t------gaggcaggctgaacctgcagatatgcgcccggagatatggat-
A0A2I2YQ13_BCL2L11      -------------------------------------agagaaataga--
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      t------gaggcaggctgaacctgcagatatgcgcccggagatatggat-
A0A2I2YQ13_BCL2L11      t------gaggcaggctgaacctgcagatatgcgcccggagatatggat-
A0A2I2YQ13_BCL2L11      t------gaggcaggctgaacctgcagatatgcgcccggagatatggat-
A0A2I2YQ13_BCL2L11      t------gaggcaggctgaacctgcagatatgcgcccggagatatggat-
A0A2I2YQ13_BCL2L11      --------------------------------------------------
G3QIN5_BMF-02           gtggggtgactgaggaac--cccagcgactcttttatg------------
G3QIN5_BMF-01           gtggggtgactgaggaac--cccagcgactcttttatggcaatgctggc-
A0A2I2Z8C7_BAD-03       gaacttgggcaggggaagc-tccgcc----ccctcccagtgaccttcgct
A0A2I2Z8C7_BAD-04       acgaagggatgggggaggagcccagc----ccctttcggggccgctcgc-
A0A2I2Z8C7_BAD-02       acgaagggatgggggaggagcccagc----ccctttcggggccgctcgc-
A0A2I2Z8C7_BAD-01       acgaagggatgggggaggagcccagc----ccctttcggggccgctcgc-
                                                                          

G3QCT2_BIK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
G3QIN5_BMF-01           ------------tatcggcttcctctccctgccagtttcccagcagtctt
A0A2I2Z8C7_BAD-03       gcacatcccgaaactccacccgttcccactgcc-----------------
A0A2I2Z8C7_BAD-04       ------------gctcggcgccccccaac--ct-----------------
A0A2I2Z8C7_BAD-02       ------------gctcggcgccccccaac--ct-----------------
A0A2I2Z8C7_BAD-01       ------------gctcggcgccccccaac--ct-----------------
                                                                          

G3QCT2_BIK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
G3QIN5_BMF-01           gcccattggggagcagccccccgaagggcagtggcaacatcgagcagagg
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
                                                                          

G3QCT2_BIK-01           ----------------------------------------------gaac
G3QTJ6_HRK-01           ---------------------------------------------ggccg
A0A2I2YVQ5_PMAIP1-      -------------------------------------------------t
A0A2I2YVQ5_PMAIP1-      -------------------------------------------------t
A0A2I2YQ13_BCL2L11      -------------------------------------------------t
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      -------------------------------------------------c
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      -------------------------------------------------c
A0A2I2YQ13_BCL2L11      -------------------------------------------------c
A0A2I2YQ13_BCL2L11      -------------------------------------------------c
A0A2I2YQ13_BCL2L11      -------------------------------------------------c
A0A2I2YQ13_BCL2L11      --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
G3QIN5_BMF-01           tacagattgcccgaaagcttcagtgcattgcagaccagttccaccggctt
A0A2I2Z8C7_BAD-03       -------------------------ctgggcagc-catcttgaatacggg
A0A2I2Z8C7_BAD-04       -------------------------ctgggcagcacagc---gctatggc
A0A2I2Z8C7_BAD-02       -------------------------ctgggcagcacagc---gctatggc
A0A2I2Z8C7_BAD-01       -------------------------ctgggcagcacagc---gctatggc
                                                                          

G3QCT2_BIK-01           aggtgctgctggcgctgctgctgctgctggcgctgctgctgccgctgctc
G3QTJ6_HRK-01           cgcaggtggcggcgctggcggcct----------------ggctgctcgg
A0A2I2YVQ5_PMAIP1-      caggaa-------cctgactgcatcaaaaacttgcatgaggggactcctt
A0A2I2YVQ5_PMAIP1-      caggaa-------cctga--------------------------------
A0A2I2YQ13_BCL2L11      ggcttagatttgtatggccaccaccatagtcaagatacagaacaactcaa
A0A2I2YQ13_BCL2L11      ccctcagaattgccctt----cataggga---agttcagtggccactcga
A0A2I2YQ13_BCL2L11      gcccaagagttgcggcg----tatcggagacgagtttaacgcttactatg
A0A2I2YQ13_BCL2L11      ----ggaagttgtcgtg----tag--------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      gcccaagagttgcggcg----tatcggagacgagtttaacgcttactatg
A0A2I2YQ13_BCL2L11      gcccaagagttgcggcg----tatcggagacgagtttaacgcttactatg
A0A2I2YQ13_BCL2L11      gcccaagagttgcggcg----tatcggagacgagtttaacgcttactatg
A0A2I2YQ13_BCL2L11      gcccaagagttgcggcg----tatcggagacgagtttaacgcttactatg
A0A2I2YQ13_BCL2L11      ---------------------taactgggactag----------------
G3QIN5_BMF-02           ------------caccagcagaaccaaaatcgtgtgtggtggca------
G3QIN5_BMF-01           catgtgcagcaacaccagcagaaccaaaatcgtgtgtggtggca------
A0A2I2Z8C7_BAD-03       cggaagtacttccctcaggcctatgcaaaaagaggatccgtgct------
A0A2I2Z8C7_BAD-04       cgcgag-------ctccggaggatga------------------------
A0A2I2Z8C7_BAD-02       cgcgag-------ctccggaggatgagtgacgagtttgtggactccttta
A0A2I2Z8C7_BAD-01       cgcgag-------ctccggaggatgagtgacgagtttgtggactccttta
                                                                          

G3QCT2_BIK-01           agtgggggcctgcacctgctg-----------------------------
G3QTJ6_HRK-01           caggcggaacttgtag----------------------------------
A0A2I2YVQ5_PMAIP1-      caaaagagttttctca-----ggaggtgcacatttcatcagtttgaagaa
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YQ13_BCL2L11      ccacaaggatttctca----------tga---------------------
A0A2I2YQ13_BCL2L11      gtggttagcaaaatca-------agctaa---------------------
A0A2I2YQ13_BCL2L11      caaggaggct-------------ggcaaaactcctggcatcctccacctg
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      ------gggtattttt-------gaataa---------------------
A0A2I2YQ13_BCL2L11      caaggagggtattttt-------gaataattaccaagcagccgaagacca
A0A2I2YQ13_BCL2L11      caaggagggtattttt-------gaataattaccaagcagccgaagacca
A0A2I2YQ13_BCL2L11      caaggaggatgcctcttccacctgattaa---------------------
A0A2I2YQ13_BCL2L11      caaggaggtt---------agagaaatag---------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
G3QIN5_BMF-02           -----gatcctcctcttcctgca-------------caaccttg------
G3QIN5_BMF-01           -----gatcctcctcttcctgca-------------caaccttg------
A0A2I2Z8C7_BAD-03       ------------gtctcctttggagggaaggc----tgacccagattc--
A0A2I2Z8C7_BAD-04       --------------------------------------------------
A0A2I2Z8C7_BAD-02       agaagggacttcctcgcccgaagagcgcaggcacagcaacgcagatgcgg
A0A2I2Z8C7_BAD-01       agaagggacttcctcgcccgaagagcgcaggcacagcaacgcagatgcgg
                                                                          

G3QCT2_BIK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      agactgcattgtaattgggaggaatgtgaaggtgcattcatgggtgccct
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      a-------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      cccacgaatggttatcttacgactgttacgttacattgtccgcctggtgt
A0A2I2YQ13_BCL2L11      cccacgaatggttatcttacgactgttacgttacattgtccgcctggtgt
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
G3QIN5_BMF-02           -----------------------ctttgaatggagaagagaacaggaacg
G3QIN5_BMF-01           -----------------------ctttgaatggagaagagaacaggaacg
A0A2I2Z8C7_BAD-03       ----------------------ccttccggtgcgtgtga-----------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
A0A2I2Z8C7_BAD-02       caaagctccagctggacgcgagtcttccagtcctggtgggatcggaactt
A0A2I2Z8C7_BAD-01       caaagctccagctggacgcgagtcttccagtcctggtgggatcggaactt
                                                                          

G3QCT2_BIK-01           ----------------------ctcaagtga
G3QTJ6_HRK-01           -------------------------------
A0A2I2YVQ5_PMAIP1-      tggaaacggaagatggaatacatcaaagtga
A0A2I2YVQ5_PMAIP1-      -------------------------------
A0A2I2YQ13_BCL2L11      -------------------------------
A0A2I2YQ13_BCL2L11      -------------------------------
A0A2I2YQ13_BCL2L11      -------------------------------
A0A2I2YQ13_BCL2L11      -------------------------------
A0A2I2YQ13_BCL2L11      -------------------------------
A0A2I2YQ13_BCL2L11      ggagaatgcattga-----------------
A0A2I2YQ13_BCL2L11      ggagaatgcattga-----------------
A0A2I2YQ13_BCL2L11      -------------------------------
A0A2I2YQ13_BCL2L11      -------------------------------
A0A2I2YQ13_BCL2L11      -------------------------------
G3QIN5_BMF-02           gggcagg--------------ccctag----
G3QIN5_BMF-01           gggcagg--------------ccctaggtga
A0A2I2Z8C7_BAD-03       -------------------------------
A0A2I2Z8C7_BAD-04       -------------------------------
A0A2I2Z8C7_BAD-02       gggcaggggaagctccgccccctcccagtga
A0A2I2Z8C7_BAD-01       gggcaggggaagctccgccccctcccagtga
                                                       

© 1998-2018