Dataset for CDS BMF of organism Gorilla gorilla gorilla

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3QIN5_BMF-02      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggg
G3QIN5_BMF-01      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggg
                   ************************************************************

G3QIN5_BMF-02      gagccggtgacccaacccgggagcttgctctctgctgacctgtttgcccagagcctactg
G3QIN5_BMF-01      gagccggtgacccaacccgggagcttgctctctgctgacctgtttgcccagagcctactg
                   ************************************************************

G3QIN5_BMF-02      gactgccccctcagccgacttcagctcttccctctcacccactgctgtggccctggcctt
G3QIN5_BMF-01      gactgccccctcagccgacttcagctcttccctctcacccactgctgtggccctggcctt
                   ************************************************************

G3QIN5_BMF-02      cgacccaccagccaggaagacaaagctacccagaccctcagcccagcctcccccagccaa
G3QIN5_BMF-01      cgacccaccagccaggaagacaaagctacccagaccctcagcccagcctcccccagccaa
                   ************************************************************

G3QIN5_BMF-02      ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatg--------
G3QIN5_BMF-01      ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgct
                   ****************************************************        

G3QIN5_BMF-02      ------------------------------------------------------------
G3QIN5_BMF-01      ggctatcggcttcctctccctgccagtttcccagcagtcttgcccattggggagcagccc
                                                                               

G3QIN5_BMF-02      ------------------------------------------------------------
G3QIN5_BMF-01      cccgaagggcagtggcaacatcgagcagaggtacagattgcccgaaagcttcagtgcatt
                                                                               

G3QIN5_BMF-02      ---------------------------------caccagcagaaccaaaatcgtgtgtgg
G3QIN5_BMF-01      gcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccaaaatcgtgtgtgg
                                                    ***************************

G3QIN5_BMF-02      tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggg
G3QIN5_BMF-01      tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggg
                   ************************************************************

G3QIN5_BMF-02      gcaggccctag----
G3QIN5_BMF-01      gcaggccctaggtga
                   ***********    

© 1998-2019