Dataset for CDS BAD of organism Gorilla gorilla gorilla

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2I2Z8C7_BAD-03      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
A0A2I2Z8C7_BAD-02      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
A0A2I2Z8C7_BAD-01      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
A0A2I2Z8C7_BAD-04      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc

A0A2I2Z8C7_BAD-03      tgcagagaggggcctgggccccagccccgcaggggacgggccctcaggct
A0A2I2Z8C7_BAD-02      tgcagagaggggcctgggccccagccccgcaggggacgggccctcaggct
A0A2I2Z8C7_BAD-01      tgcagagaggggcctgggccccagccccgcaggggacgggccctcaggct
A0A2I2Z8C7_BAD-04      tgcagagaggggcctgggccccagccccgcaggggacgggccctcaggct

A0A2I2Z8C7_BAD-03      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2I2Z8C7_BAD-02      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2I2Z8C7_BAD-01      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2I2Z8C7_BAD-04      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac

A0A2I2Z8C7_BAD-03      cagcaggagcagccaaccagcagcagccatcatggagaagggacttcct-
A0A2I2Z8C7_BAD-02      cagcaggagcagccaaccagcagcagccatcatg----------------
A0A2I2Z8C7_BAD-01      cagcaggagcagccaaccagcagcagccatcatg----------------
A0A2I2Z8C7_BAD-04      cagcaggagcagccaaccagcagcagccatcatggagggagaacttcgta

A0A2I2Z8C7_BAD-03      --------------------------------------------------
A0A2I2Z8C7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-01      --------------------------------------------------
A0A2I2Z8C7_BAD-04      ttctccttcttgggaatctgaggactctgaaaatcccagtgcagggatgc

A0A2I2Z8C7_BAD-03      --------------------------------------------------
A0A2I2Z8C7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-01      --------------------------------------------------
A0A2I2Z8C7_BAD-04      tcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcc

A0A2I2Z8C7_BAD-03      ---cgcccgaagagcgcaggcacagcaacgcagatgcggcaaagctccag
A0A2I2Z8C7_BAD-02      ------------------------gaggcgctggggctgtggagatccgg
A0A2I2Z8C7_BAD-01      ------------------------gaggcgctggggctgtggagatccgg
A0A2I2Z8C7_BAD-04      caacacgcagagaatgtaaagctagaggcgctggggctgtggagatccgg
                                               *   *** *  ** *   ** *** *

A0A2I2Z8C7_BAD-03      ctggacgcgagtcttccagtcctggtgggat------cggaacttgggca
A0A2I2Z8C7_BAD-02      --agtcgccacagctcctaccccgcggggacggaggacgacgaagggatg
A0A2I2Z8C7_BAD-01      --agtcgccacagctcctaccccgcggggacggaggacgacgaagggatg
A0A2I2Z8C7_BAD-04      --agtcgccacagctcctaccccgcggggacggaggacgacgaagggatg
                          * *** *    ***   ** *  ****       **      **   

A0A2I2Z8C7_BAD-03      ggggaagc-tccgccccctcccagtgaccttcgctgcacatcccgaaact
A0A2I2Z8C7_BAD-02      ggggaggagcccagcccctttcggggccgctcgc-------------gct
A0A2I2Z8C7_BAD-01      ggggaggagcccagcccctttcggggccgctcgc-------------gct
A0A2I2Z8C7_BAD-04      ggggaggagcccagcccctttcggggccgctcgc-------------gct
                       ***** *   **  *****  * * * *  ****              **

A0A2I2Z8C7_BAD-03      ccacccgttcccactgccctgggcagc-catcttgaatacgggcggaagt
A0A2I2Z8C7_BAD-02      cggcgccccccaac--ctctgggcagcacagc---gctatggccgcgag-
A0A2I2Z8C7_BAD-01      cggcgccccccaac--ctctgggcagcacagc---gctatggccgcgag-
A0A2I2Z8C7_BAD-04      cggcgccccccaac--ctctgggcagcacagc---gctatggccgcgag-
                       *  * *   ** **  * ********* ** *     ** ** **  ** 

A0A2I2Z8C7_BAD-03      acttccctcaggcctatgcaaaaagag-----------------------
A0A2I2Z8C7_BAD-02      ------ctccggaggatgagtgacgagtttgtggactcctttaagaaggg
A0A2I2Z8C7_BAD-01      ------ctccggaggatgagtgacgagtttgtggactcctttaagaaggg
A0A2I2Z8C7_BAD-04      ------ctccggaggatga-------------------------------
                             *** **   ***                                

A0A2I2Z8C7_BAD-03      --------------------------------------------------
A0A2I2Z8C7_BAD-02      acttcctcgcccgaagagcgcaggcacagcaacgcagatgcggcaaagct
A0A2I2Z8C7_BAD-01      acttcctcgcccgaagagcgcaggcacagcaacgcagatgcggcaaagct
A0A2I2Z8C7_BAD-04      --------------------------------------------------

A0A2I2Z8C7_BAD-03      ------------gatccgtgctgtctcctttggagggaaggctgacccag
A0A2I2Z8C7_BAD-02      ccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
A0A2I2Z8C7_BAD-01      ccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
A0A2I2Z8C7_BAD-04      --------------------------------------------------

A0A2I2Z8C7_BAD-03      ---attcccttccggtgcgtgtga
A0A2I2Z8C7_BAD-02      ggaagctccgccccctcccagtga
A0A2I2Z8C7_BAD-01      ggaagctccgccccctcccagtga
A0A2I2Z8C7_BAD-04      ------------------------

© 1998-2019