Dataset for CDS classical BH3-containing proteins of organism Gallus gallus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1D5PAR2_PMAIP1-      atga--tgccc-----------------------------------ggca
A9XRG9_BMF-02           atggatcgccccagctacctggaagaggactattctagcctggatgggct
A9XRG9_BMF-01           atggatcgccccagctacctggaagaggactattctagcctggatgggct
A9XRG9_BMF-03           atggatcgccccagctacctggaagaggactattctagcctggatgggct
A9XRG9_BMF-04           atggatcgccccagctacctggaagaggactattctagcctggatgggct
A9XRH0_BMF-01           atggatcgccccagctacctggaagaggactattctagcctggatgggct
                        ***    ****                                   *** 

A0A1D5PAR2_PMAIP1-      ggacgat-------------------------------------------
A9XRG9_BMF-02           ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A9XRG9_BMF-01           ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A9XRG9_BMF-03           ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A9XRG9_BMF-04           ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A9XRH0_BMF-01           ggacgatgacgtgtttcactctgatgactttggacttgca----------
                        *******                                           

A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A9XRG9_BMF-02           gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A9XRG9_BMF-01           gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A9XRG9_BMF-03           gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A9XRG9_BMF-04           gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A9XRH0_BMF-01           --------------------------------------------------
                                                                          

A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A9XRG9_BMF-02           cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A9XRG9_BMF-01           cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A9XRG9_BMF-03           cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A9XRG9_BMF-04           cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A9XRH0_BMF-01           --------------------------------------------------
                                                                          

A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A9XRG9_BMF-02           tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A9XRG9_BMF-01           tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A9XRG9_BMF-03           tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A9XRG9_BMF-04           tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A9XRH0_BMF-01           --------------------------------------------------
                                                                          

A0A1D5PAR2_PMAIP1-      --------------------------------------------------
A9XRG9_BMF-02           cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A9XRG9_BMF-01           cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A9XRG9_BMF-03           cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A9XRG9_BMF-04           cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A9XRH0_BMF-01           --------------------------------------------------
                                                                          

A0A1D5PAR2_PMAIP1-      -----------------------------tcgcaaacctgcgccgcccgc
A9XRG9_BMF-02           cggagactcttctatgggaatgctggttaccgcttacatgtccctccagt
A9XRG9_BMF-01           cggagactcttctatgggaatgctggttaccgcttacatgtccctccagt
A9XRG9_BMF-03           cggagactcttctatgggaatgctggttaccgcttacatgtccctccagt
A9XRG9_BMF-04           cggagactcttctatgggaatgctggttaccgcttacatgtccctccagt
A9XRH0_BMF-01           ---------------gggaatgctggttaccgcttacatgtccctccagt
                                                      ***  ** **  ** ** * 

A0A1D5PAR2_PMAIP1-      cgcgcctgcag------------------------------------agc
A9XRG9_BMF-02           tggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
A9XRG9_BMF-01           tggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
A9XRG9_BMF-03           tggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
A9XRG9_BMF-04           tggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
A9XRH0_BMF-01           tggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
                         *    ****                                     ***

A0A1D5PAR2_PMAIP1-      gggacgcggtggctga-gtgc-----gcgctggagctgcgcaggatcgga
A9XRG9_BMF-02           gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgca
A9XRG9_BMF-01           gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgca
A9XRG9_BMF-03           gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgca
A9XRG9_BMF-04           gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgca
A9XRH0_BMF-01           gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgca
                        **** **     **** ****     ** * * ** ***   * ** * *

A0A1D5PAR2_PMAIP1-      gacaaggcggacctgc-----------------------------agcag
A9XRG9_BMF-02           gaccagttccaccggctccacatacagcgggtagggtgtttccacagggg
A9XRG9_BMF-01           gaccagttccaccggctccacatacagcgggtagggtgtttccacagggg
A9XRG9_BMF-03           gaccagttccaccggctccacatacagc------ggcatcagcagaacag
A9XRG9_BMF-04           gaccagttccaccggctccacatacagc------ggcatcagcagaacag
A9XRH0_BMF-01           gaccagttccaccggctccacatacagc------ggcatcagcagaacag
                        *** **    *** **                             *   *

A0A1D5PAR2_PMAIP1-      aa------------------------------------------------
A9XRG9_BMF-02           aa---------ggtggggtctttcttatctaagagtggtgctccagaaga
A9XRG9_BMF-01           aa---------ggtggggtctttcttatctaagagtggtgctccagaaga
A9XRG9_BMF-03           aaatcaagtgtggtggcagctttttctctt-----------tctacacaa
A9XRG9_BMF-04           aaatcaagtgtggtggcagctttttctctt-----------tctacacaa
A9XRH0_BMF-01           aaatcaagtgtggtggcagctttttctctt-----------tctacacaa
                        **                                                

A0A1D5PAR2_PMAIP1-      ---agtcctgaacctcatcacga-------------------aactgttc
A9XRG9_BMF-02           c-tggctccaggcttcg-gctaagcaggctgttgcctaaggcagccgca-
A9XRG9_BMF-01           c-tggctccaggcttcg-gctaagcaggctgttgcctaaggcagccgca-
A9XRG9_BMF-03           cttggccttaaacgtggaggcgaacagg--------------aaccgcac
A9XRG9_BMF-04           cttggccttaaacgtggaggcgaacagg--------------aaccgcac
A9XRH0_BMF-01           cttggccttaaacgtggaggcgaacagg--------------aaccgcac
                            *       * *       *                   * * *   

A0A1D5PAR2_PMAIP1-      t--gccccaaaacgtga
A9XRG9_BMF-02           --ggctaccggcagtga
A9XRG9_BMF-01           --ggctaccggcagtga
A9XRG9_BMF-03           tggg----cagaggtga
A9XRG9_BMF-04           tggg----cagaggtga
A9XRH0_BMF-01           tggg----cagaggtga
                           *         ****

© 1998-2019