Dataset for CDS classical BH3-containing proteins of organism Gallus gallus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A9XRG9_BMF-01           atgg------------------------atcgccccagctacctggaaga
A9XRG9_BMF-02           atgg------------------------atcgccccagctacctggaaga
A9XRG9_BMF-03           atgg------------------------atcgccccagctacctggaaga
A9XRG9_BMF-04           atgg------------------------atcgccccagctacctggaaga
A9XRH0_BMF-01           atgg------------------------atcgccccagctacctggaaga
A0A1D5PAR2_PMAIP1-      atga-----------------------------------tgcccggc--a
A0A3Q2U844_BCL2L11      atggccaagcagccccccgaggcgaaggcgccccgcgaccgccgggc--c
                        ***                                      ** **    

A9XRG9_BMF-01           ggactattctagcctg--gatgggctgga---------------------
A9XRG9_BMF-02           ggactattctagcctg--gatgggctgga---------------------
A9XRG9_BMF-03           ggactattctagcctg--gatgggctgga---------------------
A9XRG9_BMF-04           ggactattctagcctg--gatgggctgga---------------------
A9XRH0_BMF-01           ggactattctagcctg--gatgggctgga---------------------
A0A1D5PAR2_PMAIP1-      ggacgatt------------------------------------------
A0A3Q2U844_BCL2L11      gggcggctgccgccgggagaggggccgggcccggccgtcccgctgcggcc
                        ** *   *                                          

A9XRG9_BMF-01           --------------cgatgacgtgtttcactctgatgactttggacttgc
A9XRG9_BMF-02           --------------cgatgacgtgtttcactctgatgactttggacttgc
A9XRG9_BMF-03           --------------cgatgacgtgtttcactctgatgactttggacttgc
A9XRG9_BMF-04           --------------cgatgacgtgtttcactctgatgactttggacttgc
A9XRH0_BMF-01           --------------cgatgacgtgtttcactctgatgactttggacttgc
A0A1D5PAR2_PMAIP1-      --------------cgcaaacctgcgccgc-ccgccgcgcct------gc
A0A3Q2U844_BCL2L11      cggagcccccgccgcgctgcccggcgccgc-ccggcccgcctcgcccggc
                                      **    *  *   * * * *       *      **

A9XRG9_BMF-01           aggtcagcctggtgagatgactgcaactggcattttcacacagaaccagt
A9XRG9_BMF-02           aggtcagcctggtgagatgactgcaactggcattttcacacagaaccagt
A9XRG9_BMF-03           aggtcagcctggtgagatgactgcaactggcattttcacacagaaccagt
A9XRG9_BMF-04           aggtcagcctggtgagatgactgcaactggcattttcacacagaaccagt
A9XRH0_BMF-01           a-------------------------------------------------
A0A1D5PAR2_PMAIP1-      ag------------------------------------------------
A0A3Q2U844_BCL2L11      agccccggcccgttcgccatccgctcgccgctctt---------------
                        *                                                 

A9XRG9_BMF-01           cctacagctgccttctggggaggtttcaactatttcccctcacacactgc
A9XRG9_BMF-02           cctacagctgccttctggggaggtttcaactatttcccctcacacactgc
A9XRG9_BMF-03           cctacagctgccttctggggaggtttcaactatttcccctcacacactgc
A9XRG9_BMF-04           cctacagctgccttctggggaggtttcaactatttcccctcacacactgc
A9XRH0_BMF-01           --------------------------------------------------
A0A1D5PAR2_PMAIP1-      -----------------------------------------------agc
A0A3Q2U844_BCL2L11      -------cttcttcgtgcggaggtccccgctgctgccgcgctcctccagc
                                                                          

A9XRG9_BMF-01           tgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaac
A9XRG9_BMF-02           tgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaac
A9XRG9_BMF-03           tgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaac
A9XRG9_BMF-04           tgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaac
A9XRH0_BMF-01           --------------------------------------------------
A0A1D5PAR2_PMAIP1-      gg------------------------------------------------
A0A3Q2U844_BCL2L11      gg------------------------------------------------
                                                                          

A9XRG9_BMF-01           actcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtca
A9XRG9_BMF-02           actcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtca
A9XRG9_BMF-03           actcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtca
A9XRG9_BMF-04           actcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtca
A9XRH0_BMF-01           --------------------------------------------------
A0A1D5PAR2_PMAIP1-      -----g--------------------------------------------
A0A3Q2U844_BCL2L11      -----gtacttctccttcgaggccgagcgcagccccgcgcccatgagctg
                                                                          

A9XRG9_BMF-01           ctgaagagccccggagactcttctatgggaatgctggttaccgcttacat
A9XRG9_BMF-02           ctgaagagccccggagactcttctatgggaatgctggttaccgcttacat
A9XRG9_BMF-03           ctgaagagccccggagactcttctatgggaatgctggttaccgcttacat
A9XRG9_BMF-04           ctgaagagccccggagactcttctatgggaatgctggttaccgcttacat
A9XRH0_BMF-01           --------------------------gggaatgctggttaccgcttacat
A0A1D5PAR2_PMAIP1-      ----------acgcgg----------------------------------
A0A3Q2U844_BCL2L11      cgataaggccacgcagacccccagcccgccgtgccag-------------
                                                                          

A9XRG9_BMF-01           gtccctccagttggctttgcattggatccaaatctccaagaagagcctca
A9XRG9_BMF-02           gtccctccagttggctttgcattggatccaaatctccaagaagagcctca
A9XRG9_BMF-03           gtccctccagttggctttgcattggatccaaatctccaagaagagcctca
A9XRG9_BMF-04           gtccctccagttggctttgcattggatccaaatctccaagaagagcctca
A9XRH0_BMF-01           gtccctccagttggctttgcattggatccaaatctccaagaagagcctca
A0A1D5PAR2_PMAIP1-      -----------------tggctgagtgc----------------------
A0A3Q2U844_BCL2L11      -----gccgtcagccactacctgagcgccatggcttccaggtggcgatct
                                         *   *  *  *                      

A9XRG9_BMF-01           ggaaggtcagcgggaggcacgta--ctgaggtgcagattgcacggaagtt
A9XRG9_BMF-02           ggaaggtcagcgggaggcacgta--ctgaggtgcagattgcacggaagtt
A9XRG9_BMF-03           ggaaggtcagcgggaggcacgta--ctgaggtgcagattgcacggaagtt
A9XRG9_BMF-04           ggaaggtcagcgggaggcacgta--ctgaggtgcagattgcacggaagtt
A9XRH0_BMF-01           ggaaggtcagcgggaggcacgta--ctgaggtgcagattgcacggaagtt
A0A1D5PAR2_PMAIP1-      ---------------------------------------gcgctggagct
A0A3Q2U844_BCL2L11      cactcgcttgcagaagaaatacaaccagaaatatggattgcacaggagct
                                                               ** * * ** *

A9XRG9_BMF-01           gcagtgcattgcagaccagttccaccggctccac------atacagcggg
A9XRG9_BMF-02           gcagtgcattgcagaccagttccaccggctccac------atacagcggg
A9XRG9_BMF-03           gcagtgcattgcagaccagttccaccggctccac------atacagc---
A9XRG9_BMF-04           gcagtgcattgcagaccagttccaccggctccac------atacagc---
A9XRH0_BMF-01           gcagtgcattgcagaccagttccaccggctccac------atacagc---
A0A1D5PAR2_PMAIP1-      gcgcaggatcggaga-----------------------caaggcgg----
A0A3Q2U844_BCL2L11      gcggcgcatcggggatgaattcaatgcctcctattgtccaagaaggggtt
                        **   * ** *  **                         *    *    

A9XRG9_BMF-01           tagggtgtttccacaggggaa---------ggtggggtctttcttatcta
A9XRG9_BMF-02           tagggtgtttccacaggggaa---------ggtggggtctttcttatcta
A9XRG9_BMF-03           ---ggcatcagcagaacagaaatcaagtgtggtggcagctttttctctt-
A9XRG9_BMF-04           ---ggcatcagcagaacagaaatcaagtgtggtggcagctttttctctt-
A9XRH0_BMF-01           ---ggcatcagcagaacagaaatcaagtgtggtggcagctttttctctt-
A0A1D5PAR2_PMAIP1-      --------acctgcagcagaaa----------------------------
A0A3Q2U844_BCL2L11      tcttggataaccgtgctggaaac-----------------------cccc
                                          ***                             

A9XRG9_BMF-01           agagtggtgctccagaagac-tggctccaggcttcg-gctaagcaggctg
A9XRG9_BMF-02           agagtggtgctccagaagac-tggctccaggcttcg-gctaagcaggctg
A9XRG9_BMF-03           ----------tctacacaacttggccttaaacgtggaggcgaacagg---
A9XRG9_BMF-04           ----------tctacacaacttggccttaaacgtggaggcgaacagg---
A9XRH0_BMF-01           ----------tctacacaacttggccttaaacgtggaggcgaacagg---
A0A1D5PAR2_PMAIP1-      -----------------gtcctgaacctcatcacgaaactgttctgc---
A0A3Q2U844_BCL2L11      aggttgtcattctgcgcctcctgcattacatcatccgcctcatctgg---
                                           * **        *           * *    

A9XRG9_BMF-01           ttgcctaaggcagccgca---ggctaccggcagtga
A9XRG9_BMF-02           ttgcctaaggcagccgca---ggctaccggcagtga
A9XRG9_BMF-03           -----------aaccgcactggg----cagaggtga
A9XRG9_BMF-04           -----------aaccgcactggg----cagaggtga
A9XRH0_BMF-01           -----------aaccgcactggg----cagaggtga
A0A1D5PAR2_PMAIP1-      --------------ccca----------aaacgtga
A0A3Q2U844_BCL2L11      --------------agga----------tgcagtga
                                         *              ****

© 1998-2019