Dataset for CDS classical BH3-containing proteins of organism Gallus gallus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1D5PAR2_PMAIP1-      atga--tgccc-----------------------------------ggca
A9XRG9_BMF-01           atggatcgccccagctacctggaagaggactattctagcctggatgggct
A9XRG9_BMF-03           atggatcgccccagctacctggaagaggactattctagcctggatgggct
A9XRG9_BMF-02           atggatcgccccagctacctggaagaggactattctagcctggatgggct
A9XRH0_BMF-01           atggatcgccccagctacctggaagaggactattctagcctggatgggct
                        ***    ****                                   *** 

A0A1D5PAR2_PMAIP1-      ggacgat----------------------------tcgcaaacctgc---
A9XRG9_BMF-01           ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A9XRG9_BMF-03           ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A9XRG9_BMF-02           ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A9XRH0_BMF-01           ggacgatgacgtgtttcactctgatgactttggacttgca----------
                        *******                            * ***          

A0A1D5PAR2_PMAIP1-      ---------------------------------------------gccgc
A9XRG9_BMF-01           gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A9XRG9_BMF-03           gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A9XRG9_BMF-02           gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A9XRH0_BMF-01           --------------------------------------------------
                                                                          

A0A1D5PAR2_PMAIP1-      ccgccgcg------------------------------------------
A9XRG9_BMF-01           cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A9XRG9_BMF-03           cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A9XRG9_BMF-02           cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A9XRH0_BMF-01           --------------------------------------------------
                                                                          

A0A1D5PAR2_PMAIP1-      ----------cctgcagagcgggacgcggtggctgag-------------
A9XRG9_BMF-01           tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A9XRG9_BMF-03           tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A9XRG9_BMF-02           tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A9XRH0_BMF-01           --------------------------------------------------
                                                                          

A0A1D5PAR2_PMAIP1-      ------------------------tgcgcgctggagctgcgcagga---t
A9XRG9_BMF-01           cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A9XRG9_BMF-03           cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A9XRG9_BMF-02           cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A9XRH0_BMF-01           --------------------------------------------------
                                                                          

A0A1D5PAR2_PMAIP1-      cggagac---------------------------------------aagg
A9XRG9_BMF-01           cggagactcttctatggtaa-------gagcactccaacgtcac------
A9XRG9_BMF-03           cggagactcttctatgggaatgctggttaccgcttacatgtccctccagt
A9XRG9_BMF-02           cggagactcttctatgggaatgctggttaccgcttacatgtccctccagt
A9XRH0_BMF-01           ---------------gggaatgctggttaccgcttacatgtccctccagt
                                                                          

A0A1D5PAR2_PMAIP1-      cggacctgca----------------------------------------
A9XRG9_BMF-01           cagcttttca----------------------------------------
A9XRG9_BMF-03           tggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
A9XRG9_BMF-02           tggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
A9XRH0_BMF-01           tggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
                          *   * **                                        

A0A1D5PAR2_PMAIP1-      -------------------gcagaaagtcctgaacct------catcacg
A9XRG9_BMF-01           --------------------------gcaaggaaactat----cccttca
A9XRG9_BMF-03           gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgca
A9XRG9_BMF-02           gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgca
A9XRH0_BMF-01           gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgca
                                                  *    ***  *      *    * 

A0A1D5PAR2_PMAIP1-      aaactgttctgc--------------------------------------
A9XRG9_BMF-01           g--cacttcccc---------------------------------agtca
A9XRG9_BMF-03           gaccagttccaccggctccacatacagcggcatcagcagaacagaaatca
A9XRG9_BMF-02           gaccagttccaccggctccacatacagcggcatcagcagaacagaaatca
A9XRH0_BMF-01           gaccagttccaccggctccacatacagcggcatcagcagaacagaaatca
                           *  ***  *                                      

A0A1D5PAR2_PMAIP1-      --------------------------------------cccaaaacgtga
A9XRG9_BMF-01           --------ggcag---tttctttcattaaa-------gctttaa------
A9XRG9_BMF-03           agtgtggtggcagctttttctctttctacacaacttggccttaaacgtgg
A9XRG9_BMF-02           agtgtggtggcagctttttctctttctacacaacttggccttaaacgtgg
A9XRH0_BMF-01           agtgtggtggcagctttttctctttctacacaacttggccttaaacgtgg
                                                              *   **      

A0A1D5PAR2_PMAIP1-      --------------------------------
A9XRG9_BMF-01           --------------------------------
A9XRG9_BMF-03           aggcgaacaggaaccgcactgggcagaggtga
A9XRG9_BMF-02           aggcgaacaggaaccgcactgggcagaggtga
A9XRH0_BMF-01           aggcgaacaggaaccgcactgggcagaggtga
                                                        

© 1998-2018