Dataset for CDS BMF of organism Gallus gallus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A9XRG9_BMF-01      atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgac
A9XRG9_BMF-03      atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgac
A9XRG9_BMF-02      atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgac
A9XRH0_BMF-01      atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgac

A9XRG9_BMF-01      gtgtttcactctgatgactttggacttgcaggtcagcctggtgagatgactgcaactggc
A9XRG9_BMF-03      gtgtttcactctgatgactttggacttgcaggtcagcctggtgagatgactgcaactggc
A9XRG9_BMF-02      gtgtttcactctgatgactttggacttgcaggtcagcctggtgagatgactgcaactggc
A9XRH0_BMF-01      gtgtttcactctgatgactttggacttgca------------------------------

A9XRG9_BMF-01      attttcacacagaaccagtcctacagctgccttctggggaggtttcaactatttcccctc
A9XRG9_BMF-03      attttcacacagaaccagtcctacagctgccttctggggaggtttcaactatttcccctc
A9XRG9_BMF-02      attttcacacagaaccagtcctacagctgccttctggggaggtttcaactatttcccctc
A9XRH0_BMF-01      ------------------------------------------------------------

A9XRG9_BMF-01      acacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
A9XRG9_BMF-03      acacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
A9XRG9_BMF-02      acacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
A9XRH0_BMF-01      ------------------------------------------------------------

A9XRG9_BMF-01      ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A9XRG9_BMF-03      ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A9XRG9_BMF-02      ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A9XRH0_BMF-01      ------------------------------------------------------------

A9XRG9_BMF-01      cggagactcttctatggtaa-------gagcactccaacgtcac------cagcttttca
A9XRG9_BMF-03      cggagactcttctatgggaatgctggttaccgcttacatgtccctccagttggctttgca
A9XRG9_BMF-02      cggagactcttctatgggaatgctggttaccgcttacatgtccctccagttggctttgca
A9XRH0_BMF-01      ---------------gggaatgctggttaccgcttacatgtccctccagttggctttgca
                                  ** **        * * **   * *** *        ***** **

A9XRG9_BMF-01      ------------------------------------------------------------
A9XRG9_BMF-03      ttggatccaaatctccaagaagagcctcaggaaggtcagcgggaggcacgtactgaggtg
A9XRG9_BMF-02      ttggatccaaatctccaagaagagcctcaggaaggtcagcgggaggcacgtactgaggtg
A9XRH0_BMF-01      ttggatccaaatctccaagaagagcctcaggaaggtcagcgggaggcacgtactgaggtg

A9XRG9_BMF-01      ------gcaaggaaactat----cccttcag--cacttcccc------------------
A9XRG9_BMF-03      cagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
A9XRG9_BMF-02      cagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
A9XRH0_BMF-01      cagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
                         *** ****  *      *  * ***  ** **** *                  

A9XRG9_BMF-01      ---------------agtca--------ggcag---tttctttcattaaa-------gct
A9XRG9_BMF-03      catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggcc
A9XRG9_BMF-02      catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggcc
A9XRH0_BMF-01      catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggcc
                                  * ***        *****   ***** *   ** *       ** 

A9XRG9_BMF-01      ttaa--------------------------------------
A9XRG9_BMF-03      ttaaacgtggaggcgaacaggaaccgcactgggcagaggtga
A9XRG9_BMF-02      ttaaacgtggaggcgaacaggaaccgcactgggcagaggtga
A9XRH0_BMF-01      ttaaacgtggaggcgaacaggaaccgcactgggcagaggtga

© 1998-2019