Dataset for CDS BMF of organism Gallus gallus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A9XRG9_BMF-01      atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgac
A9XRG9_BMF-02      atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgac
A9XRG9_BMF-03      atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgac
A9XRG9_BMF-04      atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgac
A9XRH0_BMF-01      atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgac

A9XRG9_BMF-01      gtgtttcactctgatgactttggacttgcaggtcagcctggtgagatgactgcaactggc
A9XRG9_BMF-02      gtgtttcactctgatgactttggacttgcaggtcagcctggtgagatgactgcaactggc
A9XRG9_BMF-03      gtgtttcactctgatgactttggacttgcaggtcagcctggtgagatgactgcaactggc
A9XRG9_BMF-04      gtgtttcactctgatgactttggacttgcaggtcagcctggtgagatgactgcaactggc
A9XRH0_BMF-01      gtgtttcactctgatgactttggacttgca------------------------------

A9XRG9_BMF-01      attttcacacagaaccagtcctacagctgccttctggggaggtttcaactatttcccctc
A9XRG9_BMF-02      attttcacacagaaccagtcctacagctgccttctggggaggtttcaactatttcccctc
A9XRG9_BMF-03      attttcacacagaaccagtcctacagctgccttctggggaggtttcaactatttcccctc
A9XRG9_BMF-04      attttcacacagaaccagtcctacagctgccttctggggaggtttcaactatttcccctc
A9XRH0_BMF-01      ------------------------------------------------------------

A9XRG9_BMF-01      acacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
A9XRG9_BMF-02      acacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
A9XRG9_BMF-03      acacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
A9XRG9_BMF-04      acacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
A9XRH0_BMF-01      ------------------------------------------------------------

A9XRG9_BMF-01      ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A9XRG9_BMF-02      ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A9XRG9_BMF-03      ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A9XRG9_BMF-04      ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A9XRH0_BMF-01      ------------------------------------------------------------

A9XRG9_BMF-01      cggagactcttctatgggaatgctggttaccgcttacatgtccctccagttggctttgca
A9XRG9_BMF-02      cggagactcttctatgggaatgctggttaccgcttacatgtccctccagttggctttgca
A9XRG9_BMF-03      cggagactcttctatgggaatgctggttaccgcttacatgtccctccagttggctttgca
A9XRG9_BMF-04      cggagactcttctatgggaatgctggttaccgcttacatgtccctccagttggctttgca
A9XRH0_BMF-01      ---------------gggaatgctggttaccgcttacatgtccctccagttggctttgca

A9XRG9_BMF-01      ttggatccaaatctccaagaagagcctcaggaaggtcagcgggaggcacgtactgaggtg
A9XRG9_BMF-02      ttggatccaaatctccaagaagagcctcaggaaggtcagcgggaggcacgtactgaggtg
A9XRG9_BMF-03      ttggatccaaatctccaagaagagcctcaggaaggtcagcgggaggcacgtactgaggtg
A9XRG9_BMF-04      ttggatccaaatctccaagaagagcctcaggaaggtcagcgggaggcacgtactgaggtg
A9XRH0_BMF-01      ttggatccaaatctccaagaagagcctcaggaaggtcagcgggaggcacgtactgaggtg

A9XRG9_BMF-01      cagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
A9XRG9_BMF-02      cagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
A9XRG9_BMF-03      cagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagc--
A9XRG9_BMF-04      cagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagc--
A9XRH0_BMF-01      cagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagc--

A9XRG9_BMF-01      gtagggtgtttccacaggggaa---------ggtggggtctttcttatctaagagtggtg
A9XRG9_BMF-02      gtagggtgtttccacaggggaa---------ggtggggtctttcttatctaagagtggtg
A9XRG9_BMF-03      ----ggcatcagcagaacagaaatcaagtgtggtggcagctttttctctt----------
A9XRG9_BMF-04      ----ggcatcagcagaacagaaatcaagtgtggtggcagctttttctctt----------
A9XRH0_BMF-01      ----ggcatcagcagaacagaaatcaagtgtggtggcagctttttctctt----------
                       **  *   ** *   ***         *****   **** *    *          

A9XRG9_BMF-01      ctccagaagac-tggctccaggcttcg-gctaagcaggctgttgcctaaggcagccgca-
A9XRG9_BMF-02      ctccagaagac-tggctccaggcttcg-gctaagcaggctgttgcctaaggcagccgca-
A9XRG9_BMF-03      -tctacacaacttggccttaaacgtggaggcgaacagg--------------aaccgcac
A9XRG9_BMF-04      -tctacacaacttggccttaaacgtggaggcgaacagg--------------aaccgcac
A9XRH0_BMF-01      -tctacacaacttggccttaaacgtggaggcgaacagg--------------aaccgcac
                    ** * *  ** ****   *  * * * *   * ****              * ***** 

A9XRG9_BMF-01      --ggctaccggcagtga
A9XRG9_BMF-02      --ggctaccggcagtga
A9XRG9_BMF-03      tggg----cagaggtga
A9XRG9_BMF-04      tggg----cagaggtga
A9XRH0_BMF-01      tggg----cagaggtga
                     **    * *  ****

© 1998-2019