Dataset for CDS BMF of organism Fundulus heteroclitus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q2PJX9_BMF-01      atggaggatgaggaggatgatgtgtttgagccagatcccaactgctggcg
A0A3Q2PJX9_BMF-03      atggaggatgaggaggatgatgtgtttgagccagatcccaactgctggcg
A0A3Q2PJX9_BMF-02      atggaggatgaggaggatgatgtgtttgagccagatcccaactgctggcg
                       **************************************************

A0A3Q2PJX9_BMF-01      cacacccttcagggagataaagtgcgaagaccggggcacgcagacgcccg
A0A3Q2PJX9_BMF-03      cacacccttcagggagataaagtgcgaagaccggggcacgcagacgcccg
A0A3Q2PJX9_BMF-02      cacacccttcagggagataaagtgcgaagaccggggcacgcagacgcccg
                       **************************************************

A0A3Q2PJX9_BMF-01      gtcctgccctggcaccgaacaacggcatgctgccctgcggcgttgcggag
A0A3Q2PJX9_BMF-03      gtcctgccctggcaccgaacaacggcatgctgccctgcggcgttgcggag
A0A3Q2PJX9_BMF-02      gtcctgccctggcaccgaacaacggcatgctgccctgcggcgttgcggag
                       **************************************************

A0A3Q2PJX9_BMF-01      gagcccagacaactgttctacggtaacgcaggttttcgattgcacttccc
A0A3Q2PJX9_BMF-03      gagcccagacaactgttctacggtaacgcaggttttcgattgcacttccc
A0A3Q2PJX9_BMF-02      gagcccagacaactgttctacggtaacgcaggttttcgattgcacttccc
                       **************************************************

A0A3Q2PJX9_BMF-01      agcacattttgagcttgtcggggattttgacgcgaggcgacaggaggagc
A0A3Q2PJX9_BMF-03      agcacattttgagcttgtcggggattttgacgcgaggcgacaggaggagc
A0A3Q2PJX9_BMF-02      agcacattttgagcttgtcggggattttgacgcgaggcgacaggaggagc
                       **************************************************

A0A3Q2PJX9_BMF-01      agaacaggatggagccgttacccctgcaccagccggcagcgctcagcttg
A0A3Q2PJX9_BMF-03      agaacaggatggagccgttacccctgcaccagccggcagcgctcagcttg
A0A3Q2PJX9_BMF-02      agaacaggatggagccgttacccctgcaccagccggcagcgctcagcttg
                       **************************************************

A0A3Q2PJX9_BMF-01      gaggcctgcatcgggcagaagcttcagctgataggcgaccagtttcatcg
A0A3Q2PJX9_BMF-03      gaggcctgcatcgggcagaagcttcagctgataggcgaccagtttcatcg
A0A3Q2PJX9_BMF-02      gaggcctgcatcgggcagaagcttcagctgataggcgaccagtttcatcg
                       **************************************************

A0A3Q2PJX9_BMF-01      ggaacacttacaacag-----------------tatcatcaaaaccaaag
A0A3Q2PJX9_BMF-03      ggaacacttacaacag-----------------tatcatcaaaaccaaag
A0A3Q2PJX9_BMF-02      ggaacacttacaacagagaggctcttttcggtcttctcttgctgcaggag
                       ****************                 *    *     *   **

A0A3Q2PJX9_BMF-01      gaatcagg-ggccgctgtggtggcgcatgactgcagctcttctcagcctc
A0A3Q2PJX9_BMF-03      gaatcagg-ggccgctgtggtggcgcatgactgcagctcttctcagcctc
A0A3Q2PJX9_BMF-02      aggttgggaaaccaatgtact---acacaa--acgtctactcacagtgtc
                          *  **   **  ***  *    **  *   *  **  ** ***  **

A0A3Q2PJX9_BMF-01      ctgcttgatagggggtttgttgctggaagag--gtggagccggacggagg
A0A3Q2PJX9_BMF-03      ctgcttgatagggggtttgttgctggaagag--gtggagccggacggagg
A0A3Q2PJX9_BMF-02      caacctgctggctcgcaaattgcctgagtcgccttgctgccgaactgctg
                       *  * ** * *   *    ****  **   *   **  **** ** *  *

A0A3Q2PJX9_BMF-01      ---------------------------tga
A0A3Q2PJX9_BMF-03      ---------------------------tga
A0A3Q2PJX9_BMF-02      attctctgtgagttccctacgcttctctga
                                                  ***

© 1998-2019