Dataset for CDS classical BH3-containing proteins of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

13 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A337SW42_BCL2L11      at-------------------------------------------ggcaa
A0A337SW42_BCL2L11      at-------------------------------------------ggcaa
A0A337SW42_BCL2L11      at-------------------------------------------ggcaa
A0A337SW42_BCL2L11      at-------------------------------------------ggcaa
A0A337SW42_BCL2L11      at-------------------------------------------ggcaa
A0A337SW42_BCL2L11      at-------------------------------------------ggcaa
M3WRS0_BMF-02           atggagccgcctcagtgtgtggagg--------------------agcta
M3WRS0_BMF-01           atggagccgcctcagtgtgtggagg--------------------agcta
A0A337SUX1_PMAIP1-      at------------------------------------------------
A0A337SQ56_HRK-01       at------------------------------------------------
A0A337SAW2_BAD-01       atggggaccccagagaatcccttatctgctcccacacacgtcccaggccc
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A337SQV0_BBC3-02      at-------------------------------------------ggccc
                                                                          

A0A337SW42_BCL2L11      agcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattg
A0A337SW42_BCL2L11      agcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattg
A0A337SW42_BCL2L11      agcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattg
A0A337SW42_BCL2L11      agcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattg
A0A337SW42_BCL2L11      agcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattg
A0A337SW42_BCL2L11      agcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattg
M3WRS0_BMF-02           gaggatgatgtgttccagccagaggatgtggagccggggacccagcctgg
M3WRS0_BMF-01           gaggatgatgtgttccagccagaggatgtggagccggggacccagcctgg
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
A0A337SAW2_BAD-01       agggatgtcgggaactgagcagcgggaggcgaggaagggacccaggacga
A0A337SQV0_BBC3-03      -----tacctgggggg------------------ggggggtct-------
A0A337SQV0_BBC3-02      gagcacgccaggagggcagctccccggagcccgtagagggcctggcccgc
                                                                          

A0A337SW42_BCL2L11      cag-----------------------------------------------
A0A337SW42_BCL2L11      cag-----------------------------------------------
A0A337SW42_BCL2L11      cag-----------------------------------------------
A0A337SW42_BCL2L11      cag-----------------------------------------------
A0A337SW42_BCL2L11      cag-----------------------------------------------
A0A337SW42_BCL2L11      cag-----------------------------------------------
M3WRS0_BMF-02           gag-----------------------------------------------
M3WRS0_BMF-01           gag-----------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
A0A337SAW2_BAD-01       agg----------------------------cggtaggcagggagcaagt
A0A337SQV0_BBC3-03      -------------------------------cggt-g--------agagt
A0A337SQV0_BBC3-02      gacggcccgcgcccctttcccctcagccgcctggt-gccctcggccgtgt
                                                                          

A0A337SW42_BCL2L11      ------------------------------cctgctgagaggcctcctca
A0A337SW42_BCL2L11      ------------------------------cctgctgagaggcctcctca
A0A337SW42_BCL2L11      ------------------------------cctgctgagaggcctcctca
A0A337SW42_BCL2L11      ------------------------------cctgctgagaggcctcctca
A0A337SW42_BCL2L11      ------------------------------cctgctgagaggcctcctca
A0A337SW42_BCL2L11      ------------------------------cctgctgagaggcctcctca
M3WRS0_BMF-02           cttgctgtctgctaacctgtttgcccagagccagctggactgccccctca
M3WRS0_BMF-01           cttgctgtctgctaacctgtttgcccagagccagctggactgccccctca
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       ------------------------------gtgcccgtgccccctg----
A0A337SAW2_BAD-01       cccgcggcgggggcggagactgggtcggaagcggccacgccccctggcca
A0A337SQV0_BBC3-03      tgtgtg---tgtgcgcgcgcg-----------------------------
A0A337SQV0_BBC3-02      cctgcggcctctgcgagcccggcctgcccgccgcccccgccgcc---ccc
                                                                          

A0A337SW42_BCL2L11      gct-----------------------------------------------
A0A337SW42_BCL2L11      gct-----------------------------------------------
A0A337SW42_BCL2L11      gct-----------------------------------------------
A0A337SW42_BCL2L11      gct-----------------------------------------------
A0A337SW42_BCL2L11      gct-----------------------------------------------
A0A337SW42_BCL2L11      gct-----------------------------------------------
M3WRS0_BMF-02           gcc-----------------------------------atctgcagctct
M3WRS0_BMF-01           gcc-----------------------------------atctgcagctct
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
A0A337SAW2_BAD-01       gccctggtgacatttcaaaagctgattgggccgggtcggtgacagttccc
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A337SQV0_BBC3-02      gccctgctgccc-----------------gccgcctacctctgcgccccc
                                                                          

A0A337SW42_BCL2L11      -------------------------------------------------c
A0A337SW42_BCL2L11      -------------------------------------------------c
A0A337SW42_BCL2L11      -------------------------------------------------c
A0A337SW42_BCL2L11      -------------------------------------------------c
A0A337SW42_BCL2L11      -------------------------------------------------c
A0A337SW42_BCL2L11      -------------------------------------------------c
M3WRS0_BMF-02           tccctctcacccactgctgtgg----------------------------
M3WRS0_BMF-01           tccctctcacccactgctgtgg----------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       -----------caccgcggccg----------------------------
A0A337SAW2_BAD-01       gttgcccaggcaactagggccgggctccctcagtactggagggaggcggc
A0A337SQV0_BBC3-03      --------------------cg--------ctgtgtgggggtgactccgt
A0A337SQV0_BBC3-02      accgccccgcccgccgtcaccg--------ccgccctggggggcccccgc
                                                                          

A0A337SW42_BCL2L11      aggcctgg------------------------------------------
A0A337SW42_BCL2L11      aggcctgg------------------------------------------
A0A337SW42_BCL2L11      aggcctgg------------------------------------------
A0A337SW42_BCL2L11      aggcctgg------------------------------------------
A0A337SW42_BCL2L11      aggcctgg------------------------------------------
A0A337SW42_BCL2L11      aggcctgg------------------------------------------
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           --------------------------------------------------
A0A337SUX1_PMAIP1-      --gcctgggaagaggac---------------------------------
A0A337SQ56_HRK-01       -------------------------------------------------c
A0A337SAW2_BAD-01       aggcccgggtcaggggcctcgagatcgggcttgggcccagagcatgttcc
A0A337SQV0_BBC3-03      gggtctgt----g-------------------------------t-cgcc
A0A337SQV0_BBC3-02      tggcctgg----gggtccccgcagccggccccgagggccgcgccc-cgac
                                                                          

A0A337SW42_BCL2L11      -ggcccctacctctctacagacagagcagcaag-----------------
A0A337SW42_BCL2L11      -ggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaa
A0A337SW42_BCL2L11      -ggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaa
A0A337SW42_BCL2L11      -ggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaa
A0A337SW42_BCL2L11      -ggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaa
A0A337SW42_BCL2L11      -ggcccctacctctctacagacagagcagca-------------------
M3WRS0_BMF-02           ----tcctgggcttcgacccaccagccaggaagacaag------gccac-
M3WRS0_BMF-01           ----tcctgggcttcgacccaccagccaggaagacaag------gccac-
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       ggccccccggccgtgtgcgc--------------ctgc------agcgc-
A0A337SAW2_BAD-01       agatcccagagtttgagcccagtgagcaggaagactcc------agccct
A0A337SQV0_BBC3-03      tgtcctcagccctcactctc-----gccggcaga--gc------agcacc
A0A337SQV0_BBC3-02      ggtcctcagccctcactctc-----gccggcaga--gc------agcacc
                                                                          

A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      ggggaccgctgcccccaaggcagccctcagggcccgctggccccaccagc
A0A337SW42_BCL2L11      ggggaccgctgcccccaaggcagccctcagggcccgctggccccaccagc
A0A337SW42_BCL2L11      ggggaccgctgcccccaaggcagccctcagggcccgctggccccaccagc
A0A337SW42_BCL2L11      ggggaccgctgcccccaaggcagccctcagggcccgctggccccaccagc
A0A337SW42_BCL2L11      --------------------------------------------------
M3WRS0_BMF-02           -----ccagaccctcagtccggcctccccgagtca---gggt--gtcatg
M3WRS0_BMF-01           -----ccagaccctcagtccggcctccccgagtca---gggt--gtcatg
A0A337SUX1_PMAIP1-      --gcgtaagagcgcgcagccgagccccgcgcg------ggccccggcag-
A0A337SQ56_HRK-01       --gggccg---cctgggtctgcgctc--------------gtccgccgcg
A0A337SAW2_BAD-01       acggataggggcctgggccccagccccacagg------ggaccggccccg
A0A337SQV0_BBC3-03      tggaatcg----ccggtgcccagcgccccggg------ggccctggcggg
A0A337SQV0_BBC3-02      tggaatcg----ccggtgcccagcgccccggg------ggccctggcggg
                                                                          

A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      cagccccgggc--cttttgctaccagatccccgtttttcatctttgtcag
A0A337SW42_BCL2L11      cagccccgggc--cttttgctaccagatccccgtttttcatctttgtcag
A0A337SW42_BCL2L11      cagccccgggc--cttttgctaccagatccccgtttttcatctttgtcag
A0A337SW42_BCL2L11      cagccccgggc--cttttgctaccagatccccgtttttcatctttgtcag
A0A337SW42_BCL2L11      --------------------------------------------------
M3WRS0_BMF-02           ctgccttgtggggtgac---cgaagaaccccagcgactcttttatg----
M3WRS0_BMF-01           ctgccttgtggggtgac---cgaagaaccccagcgactcttttatggcaa
A0A337SUX1_PMAIP1-      -agcccgaagtggaatgtgccatgcagctccggaga--tt----tggaga
A0A337SQ56_HRK-01       cagct--------cacg-gccgctcggctcaaggcg--ct----cggcga
A0A337SAW2_BAD-01       cggccctggcaagcacc-agcggacgaccccaggcctcct----cgggga
A0A337SQV0_BBC3-03      cggccc-------cacc---caggcagccccgggagtccg----ggggga
A0A337SQV0_BBC3-02      cggccc-------cacc---caggcagccccgggagtccg----ggggga
                                                                          

A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      aagatcctccctgct-----------------------------------
A0A337SW42_BCL2L11      aagatcctccctgct-----------------------------------
A0A337SW42_BCL2L11      aagatcctccctgct-----------------------------------
A0A337SW42_BCL2L11      aagatcctccctgct-----------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           cgctggctaccggctccctctccctgccagtttccctgcaggcttgcccc
A0A337SUX1_PMAIP1-      ca---------aact-----------------------------------
A0A337SQ56_HRK-01       cg---------agct-----------------------------------
A0A337SAW2_BAD-01       agctggtcaccagca-----------------------------------
A0A337SQV0_BBC3-03      ggagg------agca-----------------------------------
A0A337SQV0_BBC3-02      ggagg------agca-----------------------------------
                                                                          

A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      ----gtctcgatcctccagtgggtatttctcttttgacacag-----aca
A0A337SW42_BCL2L11      ----gtctcgatcctccagtgggtatttctcttttgacacag-----aca
A0A337SW42_BCL2L11      ----gtctcgatcctccagtgggtatttctcttttgacacag-----aca
A0A337SW42_BCL2L11      ----gtctcgatcctccagtgggtatttctcttttgacacag-----aca
A0A337SW42_BCL2L11      ----------------------------------------ag-----aca
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           ttggtgagcagccccctgaagggcattggcagcatcgagcagaggtacag
A0A337SUX1_PMAIP1-      ----gaat--ttccgacag-------------------------------
A0A337SQ56_HRK-01       ----gcaccagcgcaccat-----------gtggcggcgccgcg--cgcg
A0A337SAW2_BAD-01       ----ggggcagcccgccagcagcaaccaccatggaggcgctggggctgtg
A0A337SQV0_BBC3-03      ----gtgg--gcccgggag-----------atcggggcccagctgcggcg
A0A337SQV0_BBC3-02      ----gtgg--gcccgggag-----------atcggggcccagctgcggcg
                                                                          

A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      ggagcccggcacccatgagttgtgacaa----------------------
A0A337SW42_BCL2L11      ggagcccggcacccatgagttgtgacaa----------------------
A0A337SW42_BCL2L11      ggagcccggcacccatgagttgtgacaa----------------------
A0A337SW42_BCL2L11      ggagcccggcacccatgagttgtgacaa----------------------
A0A337SW42_BCL2L11      ggagcccggcacccatgagttgtgacaa----------------------
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           attgcccgaaagcttcagtgcattgcagaccagttccatcggcttcatat
A0A337SUX1_PMAIP1-      ---------aagcttatgaatctgatat----------------------
A0A337SQ56_HRK-01       ga-gccggagggcgccggcgcccggcgc----------------------
A0A337SAW2_BAD-01       gagacccggagtcgccacagctc-gtaccccgccgggaccgaggaggatg
A0A337SQV0_BBC3-03      gatggcggacgacctcaacgcgctgtac--------gagcggcggagaca
A0A337SQV0_BBC3-02      gatggcggacgacctcaacgcgctgtac--------gagcggcggagaca
                                                                          

A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      ---------atcaacacaaaccccaagtcctccttgccaggccttcaacc
A0A337SW42_BCL2L11      ---------atcaacacaaaccccaagtcctccttgccaggccttcaacc
A0A337SW42_BCL2L11      ---------atcaacacaaaccccaagtcctccttgccaggccttcaacc
A0A337SW42_BCL2L11      ---------atcaacacaaaccccaagtcctccttgccaggccttcaacc
A0A337SW42_BCL2L11      ---------atcaacacaaaccccaagtcctccttgccaggccttcaacc
M3WRS0_BMF-02           --------------caccagcaaaaccgccgtcgagtgtggtggcagatt
M3WRS0_BMF-01           g-------cagcaacaccagcaaaaccgccgtcgagtgtggtggcagatt
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
A0A337SAW2_BAD-01       aagggacggaggaggaagagcccagccctttccggggtcgctcgcgctca
A0A337SQV0_BBC3-03      a-------gaggagcagcagcga-------------------------ca
A0A337SQV0_BBC3-02      a-------gaggagcagcagcga-------------------------ca
                                                                          

A0A337SW42_BCL2L11      ------------------cttccatgaggc--------------------
A0A337SW42_BCL2L11      attatctcagtgcaatggtt------------------------------
A0A337SW42_BCL2L11      attatctcagtgcaatggcttccatgaggc--------------------
A0A337SW42_BCL2L11      attatctcagtgcaat----------------------------------
A0A337SW42_BCL2L11      attatctcagtgcaatggcttccatgaggc--------------------
A0A337SW42_BCL2L11      attatctcagtgcaatggcttccatgaggc--------------------
M3WRS0_BMF-02           ctcctcttcctacacaacctggctttga----------------------
M3WRS0_BMF-01           ctcctcttcctacacaacctggctttga----------------------
A0A337SUX1_PMAIP1-      -------ccaaactct----------------------------------
A0A337SQ56_HRK-01       --gctccccacctactggccctggctgtgc--------------------
A0A337SAW2_BAD-01       gcgccccccaacctctgggctgccctgcgctacggccgcgagctccggag
A0A337SQV0_BBC3-03      ccgcccctca--ccctggagggtcctgtac--------------------
A0A337SQV0_BBC3-02      ccgcccctca--ccctggagggtcctgtac--------------------
                                                                          

A0A337SW42_BCL2L11      ----------------------agcctcaggctgtacccgcagatatgcg
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      ----------------------agcctcaggctgtacccgcagatatgcg
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      ----------------------agcctcaggctgtacccgcagatatgcg
A0A337SW42_BCL2L11      ----------------------agcctcaggctgtacccgcagatatgcg
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           --------------------------------------------------
A0A337SUX1_PMAIP1-      ------------------------------------tccgctc-------
A0A337SQ56_HRK-01       ---------------------------------gcggccgcgc-------
A0A337SAW2_BAD-01       gatgagcgacgagttccagggctccttcaagggacttccacgcccgaaga
A0A337SQV0_BBC3-03      -----------aatctca--------tcatgggactcctgccctt-----
A0A337SQV0_BBC3-02      -----------aatctca--------tcatgggactcctgccctt-----
                                                                          

A0A337SW42_BCL2L11      cccggagatatggattgcacaagagttgcggcgtatcggagacgaattta
A0A337SW42_BCL2L11      ---agagcaatag-------------------------------------
A0A337SW42_BCL2L11      cccggagatatggattgcacaagagttgcggcgtatcggagacgaattta
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      cccggagatatggattgcacaagagttgcggcgtatcggagacgaattta
A0A337SW42_BCL2L11      cccggagatatggattgcacaagagttgcggcgtatcggagacgaattta
M3WRS0_BMF-02           --------------atgcagaag---------------------------
M3WRS0_BMF-01           --------------atgcagaag---------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       --------------aggtggcggcgctggcggcctggctgctcg------
A0A337SAW2_BAD-01       gcgcgggcacagcgacgcagatgcggcaaagccccagctggacgcgcttc
A0A337SQV0_BBC3-03      --------------acccagggcccgcggggcccc---------------
A0A337SQV0_BBC3-02      --------------acccagggcccgcggggcccc---------------
                                                                          

A0A337SW42_BCL2L11      atgcatattacccaaggagg-----ctggcaagggtaccg----------
A0A337SW42_BCL2L11      --------------aggaaggtgtcctgtag-------------------
A0A337SW42_BCL2L11      atgcatattacccaaggagg-----ttagagcaatag-------------
A0A337SW42_BCL2L11      ------------------gggtctttttgaataa----------------
A0A337SW42_BCL2L11      atgcatattacccaaggagggtctttttgaataattaccaagcagccgaa
A0A337SW42_BCL2L11      atgcatattacccaaggagggtctttttgaataattaccaagcagccgaa
M3WRS0_BMF-02           ----------------------------agaacagga-------------
M3WRS0_BMF-01           ----------------------------agaacagga-------------
A0A337SUX1_PMAIP1-      ---------------------------------ggga-------------
A0A337SQ56_HRK-01       ----------------------------gcaggcgga-------------
A0A337SAW2_BAD-01       atccagtcctggtgggatcggaacttggggagaggag-------------
A0A337SQV0_BBC3-03      ----------------------------ggagatgga-------------
A0A337SQV0_BBC3-02      ----------------------------ggagatgga-------------
                                                                          

A0A337SW42_BCL2L11      -------------------------------------gcatcctacatct
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      gcccagccccaaatgattatcttacgactgttacgttacatcgtccgcct
A0A337SW42_BCL2L11      gcccagccccaaatgattatcttacgactgttacgttacatcgtccgcct
M3WRS0_BMF-02           --------------------------------atggggcaggtcccag--
M3WRS0_BMF-01           --------------------------------atggggcaggtcccaggt
A0A337SUX1_PMAIP1-      --------------------------------ac--------------ct
A0A337SQ56_HRK-01       --------------------------------actt------------gt
A0A337SAW2_BAD-01       --------------------------------gctccgccccctcccagt
A0A337SQV0_BBC3-03      --------------------------------gc----------ccaatt
A0A337SQV0_BBC3-02      --------------------------------gc----------ccaatt
                                                                          

A0A337SW42_BCL2L11      ga-----------------
A0A337SW42_BCL2L11      -------------------
A0A337SW42_BCL2L11      -------------------
A0A337SW42_BCL2L11      -------------------
A0A337SW42_BCL2L11      ggtatggcgattgcagtga
A0A337SW42_BCL2L11      ggtatggcgattgcagtga
M3WRS0_BMF-02           -------------------
M3WRS0_BMF-01           ga-----------------
A0A337SUX1_PMAIP1-      ga-----------------
A0A337SQ56_HRK-01       ag-----------------
A0A337SAW2_BAD-01       ga-----------------
A0A337SQV0_BBC3-03      ag-----------------
A0A337SQV0_BBC3-02      ag-----------------
                                           

© 1998-2019