Dataset for CDS BMF of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


M3WRS0_BMF-02      atggagccgcctcagtgtgtggaggagctagaggatgatgtgttccagccagaggatgtg
M3WRS0_BMF-01      atggagccgcctcagtgtgtggaggagctagaggatgatgtgttccagccagaggatgtg
                   ************************************************************

M3WRS0_BMF-02      gagccggggacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagctg
M3WRS0_BMF-01      gagccggggacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagctg
                   ************************************************************

M3WRS0_BMF-02      gactgccccctcagccatctgcagctcttccctctcacccactgctgtggtcctgggctt
M3WRS0_BMF-01      gactgccccctcagccatctgcagctcttccctctcacccactgctgtggtcctgggctt
                   ************************************************************

M3WRS0_BMF-02      cgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
M3WRS0_BMF-01      cgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
                   ************************************************************

M3WRS0_BMF-02      ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatg--------
M3WRS0_BMF-01      ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgct
                   ****************************************************        

M3WRS0_BMF-02      ------------------------------------------------------------
M3WRS0_BMF-01      ggctaccggctccctctccctgccagtttccctgcaggcttgccccttggtgagcagccc
                                                                               

M3WRS0_BMF-02      ------------------------------------------------------------
M3WRS0_BMF-01      cctgaagggcattggcagcatcgagcagaggtacagattgcccgaaagcttcagtgcatt
                                                                               

M3WRS0_BMF-02      ---------------------------------caccagcaaaaccgccgtcgagtgtgg
M3WRS0_BMF-01      gcagaccagttccatcggcttcatatgcagcaacaccagcaaaaccgccgtcgagtgtgg
                                                    ***************************

M3WRS0_BMF-02      tggcagattctcctcttcctacacaacctggctttgaatgcagaagagaacaggaatggg
M3WRS0_BMF-01      tggcagattctcctcttcctacacaacctggctttgaatgcagaagagaacaggaatggg
                   ************************************************************

M3WRS0_BMF-02      gcaggtcccag----
M3WRS0_BMF-01      gcaggtcccaggtga
                   ***********    

© 1998-2018