Dataset for CDS BMF of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


M3WRS0_BMF-01      atggagccgcctcagtgtgtggaggagctagaggatgatgtgttccagccagaggatgtg
M3WRS0_BMF-02      atggagccgcctcagtgtgtggaggagctagaggatgatgtgttccagccagaggatgtg
                   ************************************************************

M3WRS0_BMF-01      gagccggggacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagctg
M3WRS0_BMF-02      gagccggggacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagctg
                   ************************************************************

M3WRS0_BMF-01      gactgccccctcagccatctgcagctcttccctctcacccactgctgtggtcctgggctt
M3WRS0_BMF-02      gactgccccctcagccatctgcagctcttccctctcacccactgctgtggtcctgggctt
                   ************************************************************

M3WRS0_BMF-01      cgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
M3WRS0_BMF-02      cgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
                   ************************************************************

M3WRS0_BMF-01      ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgct
M3WRS0_BMF-02      ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatg--------
                   ****************************************************        

M3WRS0_BMF-01      ggctaccggctccctctccctgccagtttccctgcaggcttgccccttggtgagcagccc
M3WRS0_BMF-02      ------------------------------------------------------------
                                                                               

M3WRS0_BMF-01      cctgaagggcattggcagcatcgagcagaggtacagattgcccgaaagcttcagtgcatt
M3WRS0_BMF-02      ------------------------------------------------------------
                                                                               

M3WRS0_BMF-01      gcagaccagttccatcggcttcatatgcagcaacaccagcaaaaccgccgtcgagtgtgg
M3WRS0_BMF-02      ---------------------------------caccagcaaaaccgccgtcgagtgtgg
                                                    ***************************

M3WRS0_BMF-01      tggcagattctcctcttcctacacaacctggctttgaatgcagaagagaacaggaatggg
M3WRS0_BMF-02      tggcagattctcctcttcctacacaacctggctttgaatgcagaagagaacaggaatggg
                   ************************************************************

M3WRS0_BMF-01      gcaggtcccaggtga
M3WRS0_BMF-02      gcaggtcccag----
                   ***********    

© 1998-2019