Dataset for CDS BBC3 of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A337SQV0_BBC3-03      ------------tacctgggggg------------------ggggggtct
A0A337SQV0_BBC3-02      atggcccgagcacgccaggagggcagctccccggagcccgtagagggcct
                                      ** ** ***                   * *** **

A0A337SQV0_BBC3-03      --------------------------------------cggtg-------
A0A337SQV0_BBC3-02      ggcccgcgacggcccgcgcccctttcccctcagccgcctggtgccctcgg
                                                               ****       

A0A337SQV0_BBC3-03      -agagttgtgtg---tgtgcgcgcgcg-----------------------
A0A337SQV0_BBC3-02      ccgtgtcctgcggcctctgcgagcccggcctgcccgccgcccccgccgcc
                          * **  ** *   * **** ** **                       

A0A337SQV0_BBC3-03      --------------------------------------------------
A0A337SQV0_BBC3-02      cccgccctgctgcccgccgcctacctctgcgcccccaccgccccgcccgc
                                                                          

A0A337SQV0_BBC3-03      ------cgctgtgtgggggtgactccgtgggtctgtg-------------
A0A337SQV0_BBC3-02      cgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagcc
                              *** *    **** * * ***  ** *** *             

A0A337SQV0_BBC3-03      ------------------tcgcctgtcctcagccctcactctcgccggca
A0A337SQV0_BBC3-02      ggccccgagggccgcgccccgacggtcctcagccctcactctcgccggca
                                           ** * **************************

A0A337SQV0_BBC3-03      gagcagcacctggaatcgccggtgcccagcgccccgggggccctggcggg
A0A337SQV0_BBC3-02      gagcagcacctggaatcgccggtgcccagcgccccgggggccctggcggg
                        **************************************************

A0A337SQV0_BBC3-03      cggccccacccaggcagccccgggagtccggggggaggaggagcagtggg
A0A337SQV0_BBC3-02      cggccccacccaggcagccccgggagtccggggggaggaggagcagtggg
                        **************************************************

A0A337SQV0_BBC3-03      cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcg
A0A337SQV0_BBC3-02      cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcg
                        **************************************************

A0A337SQV0_BBC3-03      ctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcacc
A0A337SQV0_BBC3-02      ctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcacc
                        **************************************************

A0A337SQV0_BBC3-03      ctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggg
A0A337SQV0_BBC3-02      ctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggg
                        **************************************************

A0A337SQV0_BBC3-03      cccgcggggccccggagatggagcccaattag
A0A337SQV0_BBC3-02      cccgcggggccccggagatggagcccaattag
                        ********************************

© 1998-2019