Dataset for CDS BBC3 of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A337SQV0_BBC3-03      --------------------------------------------------
A0A337SQV0_BBC3-01      gtgtacctcagtgcaggggctgcccgggcatgtccccgtcaggtgcctgg
A0A337SQV0_BBC3-02      --------------------------------------------------

A0A337SQV0_BBC3-03      -----------------------------------------------tac
A0A337SQV0_BBC3-01      ggcttccttcttccctgggtgccccagggagcgccatggcccgagcacgc
A0A337SQV0_BBC3-02      -----------------------------------atggcccgagcacgc

A0A337SQV0_BBC3-03      ctgggggg------------------ggggggtct---------------
A0A337SQV0_BBC3-01      caggagggcagctccccggagcccgtagagggcctggcccgcgacggccc
A0A337SQV0_BBC3-02      caggagggcagctccccggagcccgtagagggcctggcccgcgacggccc
                        * ** ***                   * *** **               

A0A337SQV0_BBC3-03      -----------------------cggtg--------agagttgtgtg---
A0A337SQV0_BBC3-01      gcgcccctttcccctcagccgcctggtgccctcggccgtgtcctgcggcc
A0A337SQV0_BBC3-02      gcgcccctttcccctcagccgcctggtgccctcggccgtgtcctgcggcc
                                                ****         * **  ** *   

A0A337SQV0_BBC3-03      tgtgcgcgcgcg--------------------------------------
A0A337SQV0_BBC3-01      tctgcgagcccggcctgcccgccgcccccgccgcccccgccctgctgccc
A0A337SQV0_BBC3-02      tctgcgagcccggcctgcccgccgcccccgccgcccccgccctgctgccc
                        * **** ** **                                      

A0A337SQV0_BBC3-03      -----------------------------------------cgctgtgtg
A0A337SQV0_BBC3-01      gccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccct
A0A337SQV0_BBC3-02      gccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccct
                                                                 *** *    

A0A337SQV0_BBC3-03      ggggtgactccgtgggtctgtg----------------------------
A0A337SQV0_BBC3-01      ggggggcccccgctggcctgggggtccccgcagccggccccgagggccgc
A0A337SQV0_BBC3-02      ggggggcccccgctggcctgggggtccccgcagccggccccgagggccgc
                        **** * * ***  ** *** *                            

A0A337SQV0_BBC3-03      ---tcgcctgtcctcagccctcactctcgccggcagagcagcacctggaa
A0A337SQV0_BBC3-01      gccccgacggtcctcagccctcactctcgccggcagagcagcacctggaa
A0A337SQV0_BBC3-02      gccccgacggtcctcagccctcactctcgccggcagagcagcacctggaa
                            ** * *****************************************

A0A337SQV0_BBC3-03      tcgccggtgcccagcgccccgggggccctggcgggcggccccacccaggc
A0A337SQV0_BBC3-01      tcgccggtgcccagcgccccgggggccctggcgggcggccccacccaggc
A0A337SQV0_BBC3-02      tcgccggtgcccagcgccccgggggccctggcgggcggccccacccaggc

A0A337SQV0_BBC3-03      agccccgggagtccggggggaggaggagcagtgggcccgggagatcgggg
A0A337SQV0_BBC3-01      agccccgggagtccggggggaggaggagcagtgggcccgggagatcgggg
A0A337SQV0_BBC3-02      agccccgggagtccggggggaggaggagcagtgggcccgggagatcgggg

A0A337SQV0_BBC3-03      cccagctgcggcggatggcggacgacctcaacgcgctgtacgagcggcgg
A0A337SQV0_BBC3-01      cccagctgcggcggatggcggacgacctcaacgcgctgtacgagcggcgg
A0A337SQV0_BBC3-02      cccagctgcggcggatggcggacgacctcaacgcgctgtacgagcggcgg

A0A337SQV0_BBC3-03      agacaagaggagcagcagcgacaccgcccctcaccctggagggtcctgta
A0A337SQV0_BBC3-01      agacaagaggagcagcagcgacaccgcccctcaccctggagggtcctgta
A0A337SQV0_BBC3-02      agacaagaggagcagcagcgacaccgcccctcaccctggagggtcctgta

A0A337SQV0_BBC3-03      caatctcatcatgggactcctgcccttacccagggcccgcggggccccgg
A0A337SQV0_BBC3-01      caatctcatcatgggactcctgcccttacccagggcccgcggggccccgg
A0A337SQV0_BBC3-02      caatctcatcatgggactcctgcccttacccagggcccgcggggccccgg

A0A337SQV0_BBC3-03      agatggagcccaattag---------------------------------
A0A337SQV0_BBC3-01      agatggagcccaattaggtgcctgcacccgcccggtggacgtcggggact
A0A337SQV0_BBC3-02      agatggagcccaattag---------------------------------

A0A337SQV0_BBC3-03      --------------------------------------------------
A0A337SQV0_BBC3-01      tggggggcaggaccctcccacctcctgatgccctggccagcgcgggggac
A0A337SQV0_BBC3-02      --------------------------------------------------

A0A337SQV0_BBC3-03      ------------------
A0A337SQV0_BBC3-01      tttttctgcaccatgtag
A0A337SQV0_BBC3-02      ------------------

© 1998-2019