Dataset for CDS classical BH3-containing proteins of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7A7D2_BCL2L11-01      --------------------------------------------------
F7CQN5_BBC3-01         --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
F6RS78_BIK-01          --------------------------------------------------
F6TJI0_BMF-01          ctaacaggggacatggagccgcctcagtgtgtagaggagctggaggatga
                                                                         

F7A7D2_BCL2L11-01      -atggccaaacaaccttccgatgtaagttctgagtgtgacagagaa-ggc
F7CQN5_BBC3-01         -------------------gctg--------------gacaaagt-----
F7DN67_BAD-01          -atgttccagatcccagagtttg--------------agcagagtgagcc
F6RS78_BIK-01          -atgtctcaagta------------------------------gga----
F6TJI0_BMF-01          tgtgttccagccagaggatgggg--------------agccgggga----
                                                                  *      

F7A7D2_BCL2L11-01      ggacaattgcagcctgcggagaggcctcctcagctcaggcctggggcccc
F7CQN5_BBC3-01         -------tctcgcc-------------ct-------------cgcggccc
F7DN67_BAD-01          agaagactccagcc-------------ctgcagataggggcctgggcccc
F6RS78_BIK-01          -------cccgtct-------------ccagggacctctttctggacgcc
F6TJI0_BMF-01          -------cccagcc-------------caggagcttgctctctgctgacc
                                   *              *               *    **

F7A7D2_BCL2L11-01      cacctctctacagatagagcagcaaggtaatcccggaggcgaaggg---g
F7CQN5_BBC3-01         tgcaccgcgaggtccacagccctca-------------------------
F7DN67_BAD-01          agccctacgggggac-tggccctcagacccggtcaggcaccagcggacag
F6RS78_BIK-01          ttc-ctgcacgagcg-cagcccggaagccc----------tggagg----
F6TJI0_BMF-01          tgt-ttgccccgagc-cagctggactgccccctcagccatctgcgg----
                              *          **                              

F7A7D2_BCL2L11-01      accgctgcccccaaggcagccctctgggcccgctggccccaccgg---cc
F7CQN5_BBC3-01         --------ctcttgccg---gccgagcagcacctggagtcgccggtgccc
F7DN67_BAD-01          ccccaggcctcctgggggaagctggtcaccagcaggggcagccggccagc
F6RS78_BIK-01          --------ttc---------------------ctggcatgacc-------
F6TJI0_BMF-01          --------ctctt-------ccctctcacccactgctgtggcc-----ct
                                 *                     * *      **       

F7A7D2_BCL2L11-01      agccctggcccttttgctaccagatccccgtttttcatctttgtgagaag
F7CQN5_BBC3-01         ag----cgccccgggggccctggag----ggcggcc-----------c--
F7DN67_BAD-01          agcagccaccatggaggcgctggggcggtggagacc-----------cgg
F6RS78_BIK-01          ---------------------gagctcacagattcc-----------cag
F6TJI0_BMF-01          ggccttcgacccaccagccaggaagacaaggccacc-----------cag
                                                          *              

F7A7D2_BCL2L11-01      atcttccctgctgtctcgctcctccagtgggtatttctcttttgacacag
F7CQN5_BBC3-01         ---cacccaggc----agcc----ccg-----------------------
F7DN67_BAD-01          agtcgccatagctcgtaccc----cga-----------------------
F6RS78_BIK-01          agcc---------cctcccca---caa-----------------------
F6TJI0_BMF-01          accctcagtccagcctccccaagccag-----------------------
                                         *     *                         

F7A7D2_BCL2L11-01      acaggagcccggcacccatgagttgtgacaaatcaacacaaacgccaagt
F7CQN5_BBC3-01         ---ggagtccgggg----------ggag----------------------
F7DN67_BAD-01          ---ggggaccgaggatgaagggatggaa----------------------
F6RS78_BIK-01          ---ggag-------------------ag----------------------
F6TJI0_BMF-01          ---ggtgtc-----atgctgccttgtgg----------------------
                          ** *                                           

F7A7D2_BCL2L11-01      cctccttgccaagccttcaaccactatctcagtgcaatggcttccatgag
F7CQN5_BBC3-01         -------gaggagcagtgggcc---------------cgg----------
F7DN67_BAD-01          -------ggggag----gagcc---------------cggccc-cttccg
F6RS78_BIK-01          -------ggtgac-----aacc--------------gtgactc---tgtg
F6TJI0_BMF-01          -------ggtgaccgaggaaccc-----------cagcgactcttttatg
                              *   *        **                *           

F7A7D2_BCL2L11-01      gcagt---cgcaggcggtccctgcagacatgcgcccggaggtatggatcg
F7CQN5_BBC3-01         ---------gagatcggggccc----------------------------
F7DN67_BAD-01          gggccgctcgcgctcggcgccccccaacctctgggc--------tgcacg
F6RS78_BIK-01          gccatgc-------------------------------------ggctgg
F6TJI0_BMF-01          gcaatgctggctaccggctccctctccctgccagtttccctgcaggcttg
                                                                         

F7A7D2_BCL2L11-01      ctc--------aagagctgcggagaattggagacgaatttaatgcctctt
F7CQN5_BBC3-01         --------------agctgcggcggatggcggacga--------------
F7DN67_BAD-01          acgctacggccgcgagctccggaggatgagcgacgagttccaggtctcct
F6RS78_BIK-01          ccttc--------------------atcggggacgagatggaagt-----
F6TJI0_BMF-01          ccccttggtgagcagccccctgaagggcagtggcaacatcgagca-----
                                                      * * *              

F7A7D2_BCL2L11-01      acccacggagggt------------cgttttgaatcatcaccaagcagct
F7CQN5_BBC3-01         -cctgaacgcgct-----gtacgagcggcggaga-ca-agaggagcagca
F7DN67_BAD-01          tccagaaggcacttcctcgcccgaagagcgcggg-cacagcgacgcagat
F6RS78_BIK-01          -gagatggatgct-----gcccca-----------catcgctgagc----
F6TJI0_BMF-01          -gaggtacagatt-----gcccgaaaacttcagtgcattgcagaccagtt
                                   *                      **        *    

F7A7D2_BCL2L11-01      gaagcccacccccaaatgatcatcttgcgactgttacgttacatcatccg
F7CQN5_BBC3-01         gcgacaccgccc--------ctcgccctggagggtcctgtacaatctcat
F7DN67_BAD-01          gcggcaaagccc--------c-------agctggacgcgcgccatccagt
F6RS78_BIK-01          ------------------------------------------------tg
F6TJI0_BMF-01          ccatcggcttca--------tatgcagcaacaccagcagaaccgaaatcg
                                                                         

F7A7D2_BCL2L11-01      cctggtacg-----------------------------------------
F7CQN5_BBC3-01         catgggactcctgcccctaccc---------------------aggggcc
F7DN67_BAD-01          cctggtg----ggatcggaact---------------------tggggag
F6RS78_BIK-01          cctggggtggc---------------------------------------
F6TJI0_BMF-01          cgtgtggtggcagaccctgctctttctccacaacctcgctttgaacggag
                       * **                                              

F7A7D2_BCL2L11-01      --gagactgc-----------------agtga
F7CQN5_BBC3-01         gagcggccccggagatggagcccaactag---
F7DN67_BAD-01          aggaggctcc-------gccccctcccagtga
F6RS78_BIK-01          -cgtgtac------------------------
F6TJI0_BMF-01          acgagaacaggaacggggcaggtcccaggtga
                         * *                           

© 1998-2018