Dataset for CDS classical BH3-containing proteins of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       atg---------agaaagcggcggcgtcacgcagctgctaagcggcagac
F6TJI0_BMF-02           atggagccgcctcagtgtgtagaggagctggaggatgatgtgttccagcc
F6TJI0_BMF-01           atggagccgcctcagtgtgtagaggagctggaggatgatgtgttccagcc
A0A3Q2I0H2_PMAIP1-      atg-----------------------------------------------
F7DN67_BAD-01           atg-----------------------------------------------
A0A3Q2GRS5_BCL2L11      atg-------------------------ttcccggcggcggc----ggcc
A0A3Q2GWE8_BBC3-01      atggc-ccgagcacgccaggagggcagctccccggagccggtagagggcc
A0A3Q2IBL3_HRK-01       atg-----------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       ctgggattcgaactcaggccctctggtttcagagccgcgttcttcatcat
F6TJI0_BMF-02           agaggatggggagccggggacccagcccaggagcttgctc----------
F6TJI0_BMF-01           agaggatggggagccggggacccagcccaggagcttgctc----------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
F7DN67_BAD-01           gggaccccagagaacccctcccctgctcccacacacgcccagggcacgag
A0A3Q2GRS5_BCL2L11      ggggcagcgcgggccagaggcgc----------ggcgcgcggagccc---
A0A3Q2GWE8_BBC3-01      tggcccgcgacggcccgcgccccttcccgctcagccgcctggtgccc---
A0A3Q2IBL3_HRK-01       -----------tgcccgtgccccctgcaccgcggccgc---ggcccc---
                                                                          

A0A3Q2LHE3_BIK-01       --------------------------------------------atgtct
A0A3Q2LHE3_BIK-02       cgtattctgtacctaaggctgtttggtccagtgtgggagaagaaatgtct
F6TJI0_BMF-02           ----tctgctgacc----------------------tgtttgccccgagc
F6TJI0_BMF-01           ----tctgctgacc----------------------tgtttgccccgagc
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
F7DN67_BAD-01           gaagtcgacagc------------------------cgagcatccggaga
A0A3Q2GRS5_BCL2L11      ----tcggctgc------------------------cctgcggagcgcgg
A0A3Q2GWE8_BBC3-01      ----tcggccgtgtcctgcggcctctgcgagcccggcctgcccgccgcgc
A0A3Q2IBL3_HRK-01       ----ccggccgtgt--------------------------------gtgc
                                                                          

A0A3Q2LHE3_BIK-01       caagtaggacccgtctccagggacct-------------ctttctggacg
A0A3Q2LHE3_BIK-02       caagtaggacccgtctccagggacct-------------ctttctggacg
F6TJI0_BMF-02           cagctggactgccccctcagccatctgcggctcttccctctcacccactg
F6TJI0_BMF-01           cagctggactgccccctcagccatctgcggctcttccctctcacccactg
A0A3Q2I0H2_PMAIP1-      ------------cctacaaggaaggcgcgtaagtctgggc----------
F7DN67_BAD-01           cgaggaggggacccaggaaggaaggcggggggcggagagccggtccggcg
A0A3Q2GRS5_BCL2L11      cggcggcgggcgggcggcaagc----ggcaggctctgcgctgtcctggcg
A0A3Q2GWE8_BBC3-01      ccgccgcgcccgccctgctgcccgctgcctacctctgcgccc--ccgccg
A0A3Q2IBL3_HRK-01       ctgcagcgcgggcc------------gcctgggtctgcgctcgtcagccg
                                                               *          

A0A3Q2LHE3_BIK-01       ccttcctgcacgagcgcagcccggaagccctggaggttcctggcatgacc
A0A3Q2LHE3_BIK-02       ccttcctgcacgagcgcagcccggaagccctggaggttcctggcatgacc
F6TJI0_BMF-02           ctgtggc--------cctggccttcgacccaccagccaggaagacaaggc
F6TJI0_BMF-01           ctgtggc--------cctggccttcgacccaccagccaggaagacaaggc
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
F7DN67_BAD-01           gcggggagcatgtt-ccagatc----------ccagagtttgagcagagt
A0A3Q2GRS5_BCL2L11      cctctgagcgcgagtcccgggctttgtctcccccgctgcctaagtggcga
A0A3Q2GWE8_BBC3-01      c--------------cccgcccgccgtcaccgccgc--------------
A0A3Q2IBL3_HRK-01       c--------------gcagc------tcacggccgc--------------
                                                                          

A0A3Q2LHE3_BIK-01       gagctcacagagtcctcccccgacagtgacaaccgtgactctgtgg----
A0A3Q2LHE3_BIK-02       gagctcacagagtcctcccccgacagtgacaaccgtgactctgtgg----
F6TJI0_BMF-02           cacccaga--ccctcagtcc----------agcct---------------
F6TJI0_BMF-01           cacccaga--ccctcagtcc----------agcct---------------
A0A3Q2I0H2_PMAIP1-      ------------------------------agccgag-------------
F7DN67_BAD-01           gagccagaagactccagccctgcagataggggcctgggccccag------
A0A3Q2GRS5_BCL2L11      caatcagggggctccgggtc----------ggcgaaaggcgcgggctgga
A0A3Q2GWE8_BBC3-01      ---cctggggggcccccgct----------ggcctgggggc---------
A0A3Q2IBL3_HRK-01       ---cc-------------------------ggctcaaggcg---------
                                                        *                 

A0A3Q2LHE3_BIK-01       ccatgcggctggccttcatcggg-------gacgagatggaagtgag---
A0A3Q2LHE3_BIK-02       ccatgcggctggccttcatcggg-------gacgagatggaagtgag---
F6TJI0_BMF-02           ccccaagccagggtgtcatgctgcct----tgtggggtgaccgagga---
F6TJI0_BMF-01           ccccaagccagggtgtcatgctgcct----tgtggggtgaccgagga---
A0A3Q2I0H2_PMAIP1-      ccccacg-----------------------cgagccccggcaga------
F7DN67_BAD-01           ccctacgggggactggccctcagacccggtcaggcaccagcggacag---
A0A3Q2GRS5_BCL2L11      cgccgcgg-ggcccgggcccggacgc----gacgctcggaagggaagggg
A0A3Q2GWE8_BBC3-01      ccccgc----agccgtccccgagccc----cgcgccccgacgg-------
A0A3Q2IBL3_HRK-01       ctcggcgacgagctgcaccagcgcac----catgtggcggc---------
                        *                                *                

A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
F6TJI0_BMF-02           --------------------------------------------------
F6TJI0_BMF-01           --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
F7DN67_BAD-01           -----------------------ccccaggcctcctgggggaagctggtc
A0A3Q2GRS5_BCL2L11      cggataaaaaaagaccaaatggccaaacaaccttccgatgtaagttctga
A0A3Q2GWE8_BBC3-01      -----------------------tccacagccctc---------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       --------------atggatgctgccccacatcgctgagct---------
A0A3Q2LHE3_BIK-02       --------------atggatgctgccccacatcgctgagct---------
F6TJI0_BMF-02           ------------------accccagcgactcttttatggc----------
F6TJI0_BMF-01           ------------------accccagcgactcttttatggc----------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
F7DN67_BAD-01           accagcaggggcagccggccagcagcagccaccatggaggcgctggggcg
A0A3Q2GRS5_BCL2L11      gtgtgacagagaaggcggacaattgcagc--ctgcggagaggcctcctca
A0A3Q2GWE8_BBC3-01      ------------------actcttgccgg--ccgagcagc----------
A0A3Q2IBL3_HRK-01       ------------------------gccg----cgcgcgga----------
                                                                          

A0A3Q2LHE3_BIK-01       ------gcctggggtggccgtgt---------------------------
A0A3Q2LHE3_BIK-02       ------gcctggggtggccgtgt---------------------------
F6TJI0_BMF-02           ------aatgctggctacc-------------------------------
F6TJI0_BMF-01           ------aatgctggctacc-------------------------------
A0A3Q2I0H2_PMAIP1-      ------gcttgaggctg---------------------------------
F7DN67_BAD-01           gtggagacccggagtcgccatagctcgtaccccgaggggaccgaggatga
A0A3Q2GRS5_BCL2L11      gctcaggcctggggcccccacctctc------------------tacaga
A0A3Q2GWE8_BBC3-01      ------acctggagtcgcc-------------------------------
A0A3Q2IBL3_HRK-01       ------gccggagggcgcc-------------------------------
                                     *                                    

A0A3Q2LHE3_BIK-01       ---------------acagcttggccttcacct-----------------
A0A3Q2LHE3_BIK-02       ---------------acagcttggccttcacct-----------------
F6TJI0_BMF-02           ---------------ggctccctctccctgccagtttccctgcaggcttg
F6TJI0_BMF-01           ---------------ggctccctctccctgccagtttccctgcaggcttg
A0A3Q2I0H2_PMAIP1-      ---------------agtgt------------------------------
F7DN67_BAD-01           agggatggaaggggaggagcccggccccttccggggccgctcgcgctcgg
A0A3Q2GRS5_BCL2L11      tagagcagcaagacaggagcccggcacc--catgagttgtgacaaatcaa
A0A3Q2GWE8_BBC3-01      ---------------ggtgcccagcgcc--ccgggggccctggagggcgg
A0A3Q2IBL3_HRK-01       ---------------ggcgcccggcgcg--ct------------------
                                                                          

A0A3Q2LHE3_BIK-01       ---------------------------------acaaccagacaggcctg
A0A3Q2LHE3_BIK-02       ---------------------------------acaaccagacaggcctg
F6TJI0_BMF-02           c-------------------cccttggtgagcagccccctg---------
F6TJI0_BMF-01           c-------------------cccttggtgagcagccccctg---------
A0A3Q2I0H2_PMAIP1-      ---------------------------------gccattca---------
F7DN67_BAD-01           c--------------------------------gcccccca---------
A0A3Q2GRS5_BCL2L11      cacaaacgccaagtcctccttgccaagccttcaaccactatctcagtgca
A0A3Q2GWE8_BBC3-01      c--------------------------------cccacccaggcagcccc
A0A3Q2IBL3_HRK-01       c--------------------------------cccaccta---------
                                                          *               

A0A3Q2LHE3_BIK-01       aggggtgtttttagaagtttcatggatggtctcactaacct----caggg
A0A3Q2LHE3_BIK-02       aggggtgtttttagaagtttcatggatggtctcactaacct----caggg
F6TJI0_BMF-02           ------------------------aagggcagtggcaacat-cgagcaga
F6TJI0_BMF-01           ------------------------aagggcagtggcaacat-cgagcaga
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
F7DN67_BAD-01           --------------------acctctgggctgcacgacgctacggccg--
A0A3Q2GRS5_BCL2L11      atggcttccatgaggcagtcgcaggcggtccctgcagacatgcgcccgga
A0A3Q2GWE8_BBC3-01      gggagtccggggggaggaggagcagtgggcccgggagatcggggccca--
A0A3Q2IBL3_HRK-01       -------------------------ctggccctgg----ctgtgcgcg--
                                                                          

A0A3Q2LHE3_BIK-01       agaacataaggttctggagcttcctgacccgcagggacagggtaagcctg
A0A3Q2LHE3_BIK-02       agaacataaggttctggagcttcctgacccgcagggacagggtaagcctg
F6TJI0_BMF-02           ggtacagattgcccgaaaacttc--------agtgcattgcagaccagtt
F6TJI0_BMF-01           ggtacagattgcccgaaaacttc--------agtgcattgcagaccagtt
A0A3Q2I0H2_PMAIP1-      ------------------aatta--------ggagaattggagacaaact
F7DN67_BAD-01           ---------------cgagctcc--------ggaggatgagcgacgagtt
A0A3Q2GRS5_BCL2L11      ggtatggatcgctcaagagctgc--------ggagaattggagacgaatt
A0A3Q2GWE8_BBC3-01      ------------------gctgc--------ggcggatggcggacgacct
A0A3Q2IBL3_HRK-01       ------------------gccgc---------gcaggtggcg--------
                                                                          

A0A3Q2LHE3_BIK-01       agat----------------------------------------------
A0A3Q2LHE3_BIK-02       agat----------------------------------------------
F6TJI0_BMF-02           ccatcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtggt
F6TJI0_BMF-01           ccatcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtggt
A0A3Q2I0H2_PMAIP1-      gaat----------------------------------------------
F7DN67_BAD-01           ccag----------------------------------------------
A0A3Q2GRS5_BCL2L11      taat----------------------------------------------
A0A3Q2GWE8_BBC3-01      gaac----------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       ------------ttcatgaccttgactcaccttcctgcatgtgtagccct
A0A3Q2LHE3_BIK-02       ------------ttcatgaccttgactcaccttcctgcatgtgtagccct
F6TJI0_BMF-02           ggcagaccctgctctttctccacaacctcgctttgaacg-gagacgagaa
F6TJI0_BMF-01           ggcagaccctgctctttctccacaacctcgctttgaacg-gagacgagaa
A0A3Q2I0H2_PMAIP1-      ------------ttc----------------------cg-gcagaaactt
F7DN67_BAD-01           ------------gtctccttccaggcacttcctcgcccg-aagagcgcgg
A0A3Q2GRS5_BCL2L11      ------------gcctcttaccca-------------cg-gagggtcgtt
A0A3Q2GWE8_BBC3-01      ------------gcgctgtacgag-------------cg-gcggagacaa
A0A3Q2IBL3_HRK-01       ------------gcgctg--------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       ctggagccgtg-----------gagcagctgccccgtagggcacagcctc
A0A3Q2LHE3_BIK-02       ctggagccgtg-----------gagcagctgccccgtagggcacagcctc
F6TJI0_BMF-02           caggaacggggcaggtcccagcttccagccaggccaggagggtgtgctct
F6TJI0_BMF-01           caggaacggggcaggtcccag-gtgtggtaaaaatgtgaggggacccgtt
A0A3Q2I0H2_PMAIP1-      ctgaatc-------------------------------------------
F7DN67_BAD-01           gcacagcgacgcagatgcg---gcaaagccccagctgga-----------
A0A3Q2GRS5_BCL2L11      ttgaatcatcaccaagcag---ctgaagcccacccccaaatg--------
A0A3Q2GWE8_BBC3-01      gaggagcagcagcga--ca---ccgcccctcgccctggagggtcctgtac
A0A3Q2IBL3_HRK-01       --------------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       gctggttgccacagtccccaccaatccctattgtcttcttttgcctgctt
A0A3Q2LHE3_BIK-02       gctggttgccacagtccccaccaatccctattgtcttcttttgcctgctt
F6TJI0_BMF-02           ggaagtcagcaggattgcagct---------gcctctgtccgaacttctt
F6TJI0_BMF-01           agggaattggagacttctgacttgtttctcagctgccatcctgagtta--
A0A3Q2I0H2_PMAIP1-      ---------------------------------------------tcata
F7DN67_BAD-01           -----------------------------------------cgcgcgcca
A0A3Q2GRS5_BCL2L11      --------------------------------atcatcttgcgactgtta
A0A3Q2GWE8_BBC3-01      aa-----------------------------tctcatcatgggactcctg
A0A3Q2IBL3_HRK-01       --------------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       cacccattcctcctcctgcctgttccctgggcctttgggtttgagatggc
A0A3Q2LHE3_BIK-02       cacccattcctcctcctgcctgttccctgggcctttgggtttgagatggc
F6TJI0_BMF-02           cccttctctccct----gctgtggcactaatggagagaatttaaagcagc
F6TJI0_BMF-01           cccccagctcccg----gcttttgtc---------aggacttcgtgc---
A0A3Q2I0H2_PMAIP1-      gccaaactcttcc----gctcaggaacctga-------------------
F7DN67_BAD-01           tccagtcctggtg----ggatcggaacttggggagaggaggctccgcccc
A0A3Q2GRS5_BCL2L11      cgttacatcatcc----gcctggt----------acggag--------ac
A0A3Q2GWE8_BBC3-01      cccctacccaggg----gccgagcggccccggagatggag--------cc
A0A3Q2IBL3_HRK-01       ----------gcg----gcctggctgctcggcaggcggaa--------ct
                                         *                                

A0A3Q2LHE3_BIK-01       tggcttactga------
A0A3Q2LHE3_BIK-02       tggcttactga------
F6TJI0_BMF-02           cagtctggctgctctga
F6TJI0_BMF-01           ---tctcttggagttga
A0A3Q2I0H2_PMAIP1-      -----------------
F7DN67_BAD-01           ctcccagtga-------
A0A3Q2GRS5_BCL2L11      tg--cagtga-------
A0A3Q2GWE8_BBC3-01      caactag----------
A0A3Q2IBL3_HRK-01       tg--tag----------
                                         

© 1998-2019