Dataset for CDS classical BH3-containing proteins of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6RS78_BIK-01      ------------------------------------------------------------
F6RS78_BIK-02      atgagaaagcggcggcgtcacgcagctgctaagcggcagacctgggattcgaactcaggc
F7DN67_BAD-01      atggggaccccagagaacccctcccctgctcccacacacgcccagggcacgag-------
F6TJI0_BMF-01      atggagccgc------------------------------ctcagtgtgtaga-------
F6TJI0_BMF-02      atggagccgc------------------------------ctcagtgtgtaga-------
                                                                               

F6RS78_BIK-01      ------------------------------------------------------------
F6RS78_BIK-02      cctctggtttcagagccgcgttcttcatcatcgtattctgtacctaaggctg---tttgg
F7DN67_BAD-01      ---------------------------------------------gaagtcgacagccga
F6TJI0_BMF-01      ---------------------------------------------ggagctg--------
F6TJI0_BMF-02      ---------------------------------------------ggagctg--------
                                                                               

F6RS78_BIK-01      ------------------atgtctcaagtag----------------gacccgtctc---
F6RS78_BIK-02      tccagtgtgggagaagaaatgtctcaagtag----------------gacccgtctc---
F7DN67_BAD-01      gcatccggagacgaggaggggacccaggaaggaaggcggggggcggagagccggtccggc
F6TJI0_BMF-01      ---------gaggatgatgtgttccagccagaggatggggagccggggacccagccc---
F6TJI0_BMF-02      ---------gaggatgatgtgttccagccagaggatggggagccggggacccagccc---
                                       *   **   **                ** **    *   

F6RS78_BIK-01      --cagggacctctttctggac--gccttcctgcacgagcgcagc---ccgga--------
F6RS78_BIK-02      --cagggacctctttctggac--gccttcctgcacgagcgcagc---ccgga--------
F7DN67_BAD-01      ggcggggagcatgttc----cagatcccagagtttgagcagagtgagccagaagactc--
F6TJI0_BMF-01      ----aggagcttgctctctgctgacct----gtttgccccgagccagctggactgccccc
F6TJI0_BMF-02      ----aggagcttgctctctgctgacct----gtttgccccgagccagctggactgccccc
                        *** *    **    *    *     *   *  *  **    *  **        

F6RS78_BIK-01      --agcc--ctggaggtt------------------------cctggcat-----------
F6RS78_BIK-02      --agcc--ctggaggtt------------------------cctggcat-----------
F7DN67_BAD-01      -cagcc--ctgcagata-------------------ggggcctgggccccagccctac--
F6TJI0_BMF-01      tcagccatctgcggctcttccctctcacccactgctgtggccctggccttcgacccacca
F6TJI0_BMF-02      tcagccatctgcggctcttccctctcacccactgctgtggccctggccttcgacccacca
                     ****  ***  * *                         *  ***             

F6RS78_BIK-01      --------gaccgag-ctcacagagtcctcccccgacagtgacaaccgtgactctgt-gg
F6RS78_BIK-02      --------gaccgag-ctcacagagtcctcccccgacagtgacaaccgtgactctgt-gg
F7DN67_BAD-01      ----gggggactgg--ccctcaga------cccggtcaggcaccagcggacagccccagg
F6TJI0_BMF-01      gccaggaagacaaggccacccaga------ccc--tcagt--ccag----cctccccaag
F6TJI0_BMF-02      gccaggaagacaaggccacccaga------ccc--tcagt--ccag----cctccccaag
                           ***     * * ****      ***   ***   * *        *     *

F6RS78_BIK-01      cc------atgcggctggccttcatcggggacga-----------------------gat
F6RS78_BIK-02      cc------atgcggctggccttcatcggggacga-----------------------gat
F7DN67_BAD-01      cctcctgggggaagctggtcaccagcaggggcagccggccagcagcagccac-----cat
F6TJI0_BMF-01      cc-----agggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttat
F6TJI0_BMF-02      cc-----agggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttat
                   **        *   *  *    *    ***                            **

F6RS78_BIK-01      ggaagtg--agatggatgctgccccacatcgctgagctgcctggggtggccgtgtacagc
F6RS78_BIK-02      ggaagtg--agatggatgctgccccacatcgctgagctgcctggggtggccgtgtacagc
F7DN67_BAD-01      ggaggcgctgg-------------------ggcgg------tggag------------ac
F6TJI0_BMF-01      ggcaatgctggctaccggctccctctccctgccagtttccctgcag------------gc
F6TJI0_BMF-02      ggcaatgctggctaccggctccctctccctgccagtttccctgcag------------gc
                   **    *   *                   *          **  *             *

F6RS78_BIK-01      ttg-----gccttcacctacaaccagacaggcctgaggggtgtttttagaagtttcatgg
F6RS78_BIK-02      ttg-----gccttcacctacaaccagacaggcctgaggggtgtttttagaagtttcatgg
F7DN67_BAD-01      ccggagtcgccatagctcgta--cc------ccgagggga------ccgaggatgaaggg
F6TJI0_BMF-01      ttg----ccccttggtgagcagccc------cctgaaggg------cagtggcaacatcg
F6TJI0_BMF-02      ttg----ccccttggtgagcagccc------cctgaaggg------cagtggcaacatcg
                     *      ** *       *  *       **    **         *  *    *  *

F6RS78_BIK-01      atgg------------tctcactaacctcaggg---------------agaacataaggt
F6RS78_BIK-02      atgg------------tctcactaacctcaggg---------------agaacataaggt
F7DN67_BAD-01      atggaaggggagga--gcccggccccttccggggccgctcgcgctcggcgccccccaacc
F6TJI0_BMF-01      agcagaggtacagattgcccgaaaacttcagtg------------cattgcagaccagtt
F6TJI0_BMF-02      agcagaggtacagattgcccgaaaacttcagtg------------cattgcagaccagtt
                   *                * *     * ** * *                *      *   

F6RS78_BIK-01      tctggagcttcctgacccgcagggacagggtaagcctgag-------------atttcat
F6RS78_BIK-02      tctggagcttcctgacccgcagggacagggtaagcctgag-------------atttcat
F7DN67_BAD-01      tc-tgggctgc--acgacgctacggccgcgagctccggaggatgagcgacg--agttcca
F6TJI0_BMF-01      ccatcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtggtggcagaccct
F6TJI0_BMF-02      ccatcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtggtggcagaccct
                    *    *** *       **     * *      *   *              *   *  

F6RS78_BIK-01      gaccttgactca---ccttcctgcatgtgtagccctctggagccgtggagcagctgcccc
F6RS78_BIK-02      gaccttgactca---ccttcctgcatgtgtagccctctggagccgtggagcagctgcccc
F7DN67_BAD-01      ggtctccttccaggcactt-cctcgcccgaagagcgcgggcacagcgacgcagatgc---
F6TJI0_BMF-01      gctctttctccacaacctcgctttgaacggaga---cgagaacaggaacg----------
F6TJI0_BMF-02      gctctttctccacaacctcgctttgaacggaga---cgagaacaggaacg----------
                   *  **     **    **  *       * **    *  *  * *    *          

F6RS78_BIK-01      gtagggcacagcctcgctggttgc-cacagtccccaccaatccctattgtcttcttttg-
F6RS78_BIK-02      gtagggcacagcctcgctggttgc-cacagtccccaccaatccctattgtcttcttttg-
F7DN67_BAD-01      ---ggcaaagccccagctggacgcgcgccatccagtcctggtgggatcgga---acttgg
F6TJI0_BMF-01      ---gggcaggtcccag-g------------tgtggtaaaaatgtgaggggacccgttagg
F6TJI0_BMF-02      ---gggcaggtcccagct------------tccagccaggccaggagggtgtgctctgga
                      **  *   **  *              *              *  *       * * 

F6RS78_BIK-01      ------------------------------------cctgcttcacccattcctcctcct
F6RS78_BIK-02      ------------------------------------cctgcttcacccattcctcctcct
F7DN67_BAD-01      ggagaggaggct-----------------------------------ccgccccctccca
F6TJI0_BMF-01      gaattggagacttctgacttgtttctcagctgccatcctgagtta--cccccagctcccg
F6TJI0_BMF-02      agtcagcaggattgcagct---------gcctctgtccgaacttcttcccttctctccct
                                                                  *      *  ** 

F6RS78_BIK-01      gcctgttccctgggcctttgggtttgagatggctggcttac------tga
F6RS78_BIK-02      gcctgttccctgggcctttgggtttgagatggctggcttac------tga
F7DN67_BAD-01      g----------------------------------------------tga
F6TJI0_BMF-01      gcttttgtc---------aggacttcgtgc------tctcttggagttga
F6TJI0_BMF-02      gctgtggcactaatggagagaatttaaagcagccagtctggctgctctga
                   *                                              ***

© 1998-2019