Dataset for CDS BMF of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6TJI0_BMF-02      atggagccgcctcagtgtgtagaggagctggaggatgatgtgttccagccagaggatggg
F6TJI0_BMF-01      atggagccgcctcagtgtgtagaggagctggaggatgatgtgttccagccagaggatggg
                   ************************************************************

F6TJI0_BMF-02      gagccggggacccagcccaggagcttgctctctgctgacctgtttgccccgagccagctg
F6TJI0_BMF-01      gagccggggacccagcccaggagcttgctctctgctgacctgtttgccccgagccagctg
                   ************************************************************

F6TJI0_BMF-02      gactgccccctcagccatctgcggctcttccctctcacccactgctgtggccctggcctt
F6TJI0_BMF-01      gactgccccctcagccatctgcggctcttccctctcacccactgctgtggccctggcctt
                   ************************************************************

F6TJI0_BMF-02      cgacccaccagccaggaagacaaggccacccagaccctcagtccagcctccccaagccag
F6TJI0_BMF-01      cgacccaccagccaggaagacaaggccacccagaccctcagtccagcctccccaagccag
                   ************************************************************

F6TJI0_BMF-02      ggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgct
F6TJI0_BMF-01      ggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgct
                   ************************************************************

F6TJI0_BMF-02      ggctaccggctccctctccctgccagtttccctgcaggcttgccccttggtgagcagccc
F6TJI0_BMF-01      ggctaccggctccctctccctgccagtttccctgcaggcttgccccttggtgagcagccc
                   ************************************************************

F6TJI0_BMF-02      cctgaagggcagtggcaacatcgagcagaggtacagattgcccgaaaacttcagtgcatt
F6TJI0_BMF-01      cctgaagggcagtggcaacatcgagcagaggtacagattgcccgaaaacttcagtgcatt
                   ************************************************************

F6TJI0_BMF-02      gcagaccagttccatcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtgg
F6TJI0_BMF-01      gcagaccagttccatcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtgg
                   ************************************************************

F6TJI0_BMF-02      tggcagaccctgctctttctccacaacctcgctttgaacggagacgagaacaggaacggg
F6TJI0_BMF-01      tggcagaccctgctctttctccacaacctcgctttgaacggagacgagaacaggaacggg
                   ************************************************************

F6TJI0_BMF-02      gcaggtcccagcttccagccaggccaggagggtgtgctctggaagtcagcaggattgcag
F6TJI0_BMF-01      gcaggtcccag-gtgtggtaaaaatgtgaggggacccgttagggaattggagacttctga
                   ***********  *   *  *      *****    *  * *      * **  **    

F6TJI0_BMF-02      ct---------gcctctgtccgaacttcttcccttctctccctgctgtggcactaatgga
F6TJI0_BMF-01      cttgtttctcagctgccatcctgagtta--cccccagctcccggcttttgtc--------
                   **         **  *  ***  * **   ***    ***** *** * *          

F6TJI0_BMF-02      gagaatttaaagcagccagtctggctgctctga
F6TJI0_BMF-01      -aggacttcgtgc------tctcttggagttga
                    ** * **   **      ***    *   ***

© 1998-2019