Dataset for CDS classical BH3-containing proteins of organism Dipodomys ordii

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1S3FHA8_BCL2L11      ---------------atggcaaagcaaccttccgatgtaagttctgagtg
A0A1S3FHA8_BCL2L11      ---------------atggcaaagcaaccttccgatgtaagttctgagtg
A0A1S3FUQ7_BIK-01       ---------------atgtcggag----gcc---gggtctgtcaccaggg
A0A1S3FL84_BAD-01       ---------------atgttccag----atcccagagtttgagccaagtg
A0A1S3EQA2_BMF-01       ---------------atggagccg-----cctcagtgtgtg-----gagg
A0A1S3EQA2_BMF-02       attgtcccaggggagatggagccg-----cctcagtgtgtg-----gagg
                                       ***     *            **  *        *

A0A1S3FHA8_BCL2L11      tga---ccgagaaggtggacagttgcagcctgctgagaggcctccccagc
A0A1S3FHA8_BCL2L11      tga---ccgagaaggtggacagttgcagcctgctgagaggcctccccagc
A0A1S3FUQ7_BIK-01       acctcttcatcaagaccct---cctgtaccagcagat-----gcccggac
A0A1S3FL84_BAD-01       a-----gcaggaagac------tccagctcagcagacaggg-gcctgggc
A0A1S3EQA2_BMF-01       a-----gctggaggacgatgtgttccaagcagaagacggggagccaggga
A0A1S3EQA2_BMF-02       a-----gctggaggacgatgtgttccaagcagaagacggggagccaggga
                               *   * *               * *  **       **     

A0A1S3FHA8_BCL2L11      tcaggcctgg------ggcccctacc--------tccctacaga--caga
A0A1S3FHA8_BCL2L11      tcaggcctgg------ggcccctacc--------tccctacaga--caga
A0A1S3FUQ7_BIK-01       ctcggccggc-agccgggcttttcccgatcaccgagcctatgggggaaga
A0A1S3FL84_BAD-01       cccagcctct--gcccggccccaggc--------ctcctgggggaccaca
A0A1S3EQA2_BMF-01       cccagccggggagcctgctctctgct--------accctgtttgcccaga
A0A1S3EQA2_BMF-02       cccagccggggagcctgctctctgct--------accctgtttgcccaga
                            ***         *                   ***        * *

A0A1S3FHA8_BCL2L11      g----cag----ca------------------------------------
A0A1S3FHA8_BCL2L11      g----cag----caaggtaatcccgaaggcagtcccgaaggcgaagggga
A0A1S3FUQ7_BIK-01       ggtctgggaccccatgg---------------------------------
A0A1S3FL84_BAD-01       gcccccag----caggg---------------------------------
A0A1S3EQA2_BMF-01       g---tcag----c-tgg---------------------------------
A0A1S3EQA2_BMF-02       g---tcag----c-tgg---------------------------------
                        *      *    *                                     

A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      ccgctgcccccaaggcagccctcag---ggcccgctggccccaccggcca
A0A1S3FUQ7_BIK-01       --actgtc----tggagggcagtaa--------------cca----ggtg
A0A1S3FL84_BAD-01       --actgc-----caaccagccgcag--------------ccaccatggag
A0A1S3EQA2_BMF-01       --actgccccctcagccggcttcagctcttccctctcacccactgctgtg
A0A1S3EQA2_BMF-02       --actgccccctcagccggcttcagctcttccctctcacccactgctgtg
                                                                          

A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      gccctggcccttttgctaccagatccccgcttttcatctttgtgagaaga
A0A1S3FUQ7_BIK-01       gccctg--------------------------------------------
A0A1S3FL84_BAD-01       gtgctg--------------------------------------------
A0A1S3EQA2_BMF-01       gcccag--------------------------------------------
A0A1S3EQA2_BMF-02       gcccag--------------------------------------------
                                                                          

A0A1S3FHA8_BCL2L11      -----------------------------------------------aga
A0A1S3FHA8_BCL2L11      tcttccctgctgtctcgatcctccagtgggtatttctcttttgacacaga
A0A1S3FUQ7_BIK-01       -----------------------------------------------tgg
A0A1S3FL84_BAD-01       ------------------------------------------------g-
A0A1S3EQA2_BMF-01       ------------------------------------------------ga
A0A1S3EQA2_BMF-02       ------------------------------------------------ga
                                                                        * 

A0A1S3FHA8_BCL2L11      caggagcccggcacccatgagttgtgacaaatcaacacaaaccccaagtc
A0A1S3FHA8_BCL2L11      caggagcccggcacccatgagttgtgacaaatcaacacaaaccccaagtc
A0A1S3FUQ7_BIK-01       ctggtgtgcatcggcgacgaaatg-gaccagcgcctccgaagtcctcgcc
A0A1S3FL84_BAD-01       ------------ggctgtgga----gaccagg--------------agtc
A0A1S3EQA2_BMF-01       cttcgacccaccagccaggaa----gacaaggccactcagaccctcagcc
A0A1S3EQA2_BMF-02       cttcgacccaccagccaggaa----gacaaggccactcagaccctcagcc
                                      *   *      *** *                 * *

A0A1S3FHA8_BCL2L11      ctccctgcc------aggccttcaaccattatctca----gcgcaatggc
A0A1S3FHA8_BCL2L11      ctccctgcc------aggccttcaaccattatctca----gcgcaatggc
A0A1S3FUQ7_BIK-01       tggcccagctgccggggatggccatacacagcctggctctgacctacagc
A0A1S3FL84_BAD-01       ------------------------gccatagt-tca---taccctgcggg
A0A1S3EQA2_BMF-01       cggcctccc------------ccagccagggtgtcatgctgccctgtggg
A0A1S3EQA2_BMF-02       cggcctccc------------ccagccagggtgtcatgctgccctgtggg
                                                  **     *         *    * 

A0A1S3FHA8_BCL2L11      ttccatgagg------------cagtctcaggaagagcctgc--------
A0A1S3FHA8_BCL2L11      ttccatgagg------------cagtctcaggaagagcctgc--------
A0A1S3FUQ7_BIK-01       cagatgggtg----------------tctggggagtgct-----ccgacg
A0A1S3FL84_BAD-01       --gatggaggag-------gat---------gaagggctgga-agaggag
A0A1S3EQA2_BMF-01       gtgactgaagagccccagcgactcttttatggcagtgctggctaccggct
A0A1S3EQA2_BMF-02       gtgactgaagagccccagcgactcttttatggcagtgctggctaccggct
                              *  *                     * ** **            

A0A1S3FHA8_BCL2L11      -------------agatttgc---------------gcccaga-------
A0A1S3FHA8_BCL2L11      -------------agatttgc---------------gcccaga-------
A0A1S3FUQ7_BIK-01       cctcatccgt---ggggtcgc-------------ccacctgag-------
A0A1S3FL84_BAD-01       cctagcccctttcggggtcgctcacgctcggc--tcccccaaatctctgg
A0A1S3EQA2_BMF-01       cccactccctgccggtttccccgcagcccagcagccccccgaa------g
A0A1S3EQA2_BMF-02       cccactccctgccggtttccccgcagcccagcagccccccgaa------g
                                      *  *  *                **           

A0A1S3FHA8_BCL2L11      -------------gatatggatcgcccaggaattgcggcgtattggagac
A0A1S3FHA8_BCL2L11      -------------gatatggatcgcccaggaattgcggcgtattggagac
A0A1S3FUQ7_BIK-01       -------------ggcgcacat-------------cagggcctgg-----
A0A1S3FL84_BAD-01       gctgcc------aggcgcta--tggccgcgagctccggaggatgagtgac
A0A1S3EQA2_BMF-01       gccaccgcgtggaggtgcagatcgcccggaagctgcagtgcatcgccgat
A0A1S3EQA2_BMF-02       gccaccgcgtggaggtgcagatcgcccggaagctgcagtgcatcgccgat
                                     *                     * * *  *       

A0A1S3FHA8_BCL2L11      gagtttgat--gcctatt--------------atccaaggagggtatttt
A0A1S3FHA8_BCL2L11      gagtttgat--gcctatt--------------atccaaggagggtatttt
A0A1S3FUQ7_BIK-01       ---------agacccccc------atcccccgcctccaggtgtcc-----
A0A1S3FL84_BAD-01       gagtttga-cggctcctttaagggacttcctcgccccaaaagcgc-----
A0A1S3EQA2_BMF-01       cagttccatcggcttcat------acgcagcggcaccagcagcac-----
A0A1S3EQA2_BMF-02       cagttccatcggcttcat------acgcagcggcaccagcagcac-----
                                    *                      * *   *        

A0A1S3FHA8_BCL2L11      tgaataattaccaagcagccgaagaccaaccccaaatggt----tatctt
A0A1S3FHA8_BCL2L11      tgaataattaccaagcagccgaagaccaaccccaaatggt----tatctt
A0A1S3FUQ7_BIK-01       --cctggcca------ggtccgcaggcagatgctgcccgcagtgc----t
A0A1S3FL84_BAD-01       --gggcaccgccacgcagatgaggcagagttccagctggacgcgcatctt
A0A1S3EQA2_BMF-01       --cgggaccg------agcttgggggcaggtcctcctcttcctgcacaac
A0A1S3EQA2_BMF-02       --cgggaccg------agcttgggggcaggtcctcctcttcctgcacaac
                                         *         *    *                 

A0A1S3FHA8_BCL2L11      acggc--tgttacgttacatcattcgcctggtgtggagaatgca------
A0A1S3FHA8_BCL2L11      acggc--tgttacgttacatcattcgcctggtgtggagaatgca------
A0A1S3FUQ7_BIK-01       gctgctctg-----------cggagccctgcagctgctgctcca------
A0A1S3FL84_BAD-01       ccagtcttg----gtgggaccggaacttgg--gccgaggctccgcccctt
A0A1S3EQA2_BMF-01       ctggccttgaaccgagaaaacagggaccgg--gc--gggcccca------
A0A1S3EQA2_BMF-02       ctggccttgaaccgagaaaacagggaccgg--gc--gggcccca------
                           *   **           *        *  *         *       

A0A1S3FHA8_BCL2L11      ----ttga
A0A1S3FHA8_BCL2L11      ----ttga
A0A1S3FUQ7_BIK-01       ----gtga
A0A1S3FL84_BAD-01       ctcagtga
A0A1S3EQA2_BMF-01       ---ggtga
A0A1S3EQA2_BMF-02       ---ggtga
                             ***

© 1998-2018