Dataset for CDS BCL2L11 of organism Dipodomys ordii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1S3FHA8_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtgg
A0A1S3FHA8_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtgg
                        **************************************************

A0A1S3FHA8_BCL2L11      acagttgcagcctgctgagaggcctccccagctcaggcctggggccccta
A0A1S3FHA8_BCL2L11      acagttgcagcctgctgagaggcctccccagctcaggcctggggccccta
                        **************************************************

A0A1S3FHA8_BCL2L11      cctccctacagacagagcagcaaggtaatcccgaaggcagtcccgaaggc
A0A1S3FHA8_BCL2L11      cctccctacagacagagcagca----------------------------
                        **********************                            

A0A1S3FHA8_BCL2L11      gaaggggaccgctgcccccaaggcagccctcagggcccgctggccccacc
A0A1S3FHA8_BCL2L11      --------------------------------------------------
                                                                          

A0A1S3FHA8_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A1S3FHA8_BCL2L11      --------------------------------------------------
                                                                          

A0A1S3FHA8_BCL2L11      gaagatcttccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A1S3FHA8_BCL2L11      --------------------------------------------------
                                                                          

A0A1S3FHA8_BCL2L11      acagacaggagcccggcacccatgagttgtgacaaatcaacacaaacccc
A0A1S3FHA8_BCL2L11      --agacaggagcccggcacccatgagttgtgacaaatcaacacaaacccc
                          ************************************************

A0A1S3FHA8_BCL2L11      aagtcctccctgccaggccttcaaccattatctcagcgcaatggcttcca
A0A1S3FHA8_BCL2L11      aagtcctccctgccaggccttcaaccattatctcagcgcaatggcttcca
                        **************************************************

A0A1S3FHA8_BCL2L11      tgaggcagtctcaggaagagcctgcagatttgcgcccagagatatggatc
A0A1S3FHA8_BCL2L11      tgaggcagtctcaggaagagcctgcagatttgcgcccagagatatggatc
                        **************************************************

A0A1S3FHA8_BCL2L11      gcccaggaattgcggcgtattggagacgagtttgatgcctattatccaag
A0A1S3FHA8_BCL2L11      gcccaggaattgcggcgtattggagacgagtttgatgcctattatccaag
                        **************************************************

A0A1S3FHA8_BCL2L11      gagggtatttttgaataattaccaagcagccgaagaccaaccccaaatgg
A0A1S3FHA8_BCL2L11      gagggtatttttgaataattaccaagcagccgaagaccaaccccaaatgg
                        **************************************************

A0A1S3FHA8_BCL2L11      ttatcttacggctgttacgttacatcattcgcctggtgtggagaatgcat
A0A1S3FHA8_BCL2L11      ttatcttacggctgttacgttacatcattcgcctggtgtggagaatgcat
                        **************************************************

A0A1S3FHA8_BCL2L11      tga
A0A1S3FHA8_BCL2L11      tga
                        ***

© 1998-2018