Dataset for CDS BAD of organism Danio rerio

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


E7FBJ6_BAD-01      atggagaacacctcgcatgaccatcaagatgattccagcaccttggatgaaaaagagaga
A7MCM4_BAD-01      atgg-------cacatatg--------------tttaatatctccgatgattcagaga--
Q4V925_BAD-01      atgg-------cacatatg--------------tttaatatctctgatgattcagaga--
Q4V925_BAD-04      atgg-------cacatatg--------------tttaatatctctgatgattcagaga--
Q4V925_BAD-03      atgg-------cacatatg--------------tttaatatctctgatgattcagaga--
Q4V925_BAD-02      atgg-------cacatatg--------------tttaatatctctgatgattcagaga--
                   ****       * *  ***              *  *  * **  *****   *****  

E7FBJ6_BAD-01      tcacatctgaaagggacaatcaagaaccatggacaacatc--aggatcgaacatcggcca
A7MCM4_BAD-01      --------------------cagaaacaatggaagacagtgaagcctcaagcctggataa
Q4V925_BAD-01      --------------------cagaaacaatggaagacagtgaagactcaagcctggataa
Q4V925_BAD-04      --------------------cagaaacaatggaagacagtgaagactcaagcctggataa
Q4V925_BAD-03      --------------------cagaaacaatggaagacagtgaagactcaagcctggataa
Q4V925_BAD-02      --------------------cagaaacaatggaagacagtgaagactcaagcctggataa
                                       **  *** *****  ***    **  ** * * * *   *

E7FBJ6_BAD-01      acatttctcctcaagggcgtgtgcggctc----tattcggaatctca-----------ag
A7MCM4_BAD-01      aca--------caagagtgggt-cggcacagaaaaagcagcacctcactgttcctgatag
Q4V925_BAD-01      aca--------caagagtgggt-cggcacagaaaaagcagcacctcactgttcctgatag
Q4V925_BAD-04      aca--------caagagtgggt-cggcacagaaaaagcagcacctcactgttcctgatag
Q4V925_BAD-03      aca--------caagagtgggt-cggcacagaaaaagcagcacctcactgttcctgatag
Q4V925_BAD-02      aca--------caagagtgggt-cggcacagaaaaagcagcacctcactgttcctgatag
                   ***        **** * * ** **** *     *  * * * ****           **

E7FBJ6_BAD-01      tgtatacagtcagccgctggcaggacacagagacc-caggatggagcatcggtgga----
A7MCM4_BAD-01      gctgaaaggagagcaactgggcagacagaggaacctctcgatgaatga--ggaggacttg
Q4V925_BAD-01      gctgaaaggagagcaactgggcagacagaggaacctctcgatgaatga--ggaggacttg
Q4V925_BAD-04      gctgaaaggagagcaactgggcagacagaggaacctctcgatgaatga--ggaggacttg
Q4V925_BAD-03      gctgaaaggagagcaactgggcagacagaggaacctctcgatgaatga--ggaggacttg
Q4V925_BAD-02      gctgaaaggagagcaactgggcagacagaggaacctctcgatgaatga--ggaggacttg
                     *  *  *  ***  ****   **** **  *** *  **** *  *  ** ***    

E7FBJ6_BAD-01      --ggagaacggag---------------------atggacttccattcaggggtcgttct
A7MCM4_BAD-01      ctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccgagatcc
Q4V925_BAD-01      ctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccgagatcc
Q4V925_BAD-04      ctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccgagatcc
Q4V925_BAD-03      ctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccgagatcc
Q4V925_BAD-02      ctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccgagatcc
                     *** *  ****                      ***   *** ******    * ** 

E7FBJ6_BAD-01      caatcagcacctgctgcactgtggaaagcaaaaaagtatggccgtcagttgaggagaatg
A7MCM4_BAD-01      cgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatg
Q4V925_BAD-01      cgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatg
Q4V925_BAD-04      cgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatg
Q4V925_BAD-03      cgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatg
Q4V925_BAD-02      cgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatg
                   *  ***** *** ****  *****  *** ** ** ** ****  *** **** ******

E7FBJ6_BAD-01      agcgatgaattcgacacatggctcgataaaggggtgagtaagacaccgaacagc-cagaa
A7MCM4_BAD-01      agtgatga------------gtttgataaagggcagatgaagagagtaaaaagtgcagga
Q4V925_BAD-01      agtgatga------------gtttgataaagggcagatgaagagagtaaaaagtgcagga
Q4V925_BAD-04      agtgatga------------gtttgataaagggcagatgaagagagtaaaaagtgcagga
Q4V925_BAD-03      agtgatga------------gtttgataaagg---gatgaagagagtaaaaagtgcagga
Q4V925_BAD-02      agtgatga------------gtttgataaagg---gatgaagagagtaaaaagtgcagga
                   ** *****            * * ********   **  **** *   ** **  *** *

E7FBJ6_BAD-01      acagacctaccgagga--------------tggttttcgttcctctggagtcccaaagaa
A7MCM4_BAD-01      actgcgcgtcagatgagtcaatcgcccagctggttggcatttctttggagtcacaaagag
Q4V925_BAD-01      actgcgcgtcagatgagtcaatcgcccagctggttggcatttctttggagtcacaaagag
Q4V925_BAD-04      actgcgcgtcagatgagtcaatcgcccagctggttggcatttctttggagtcacaaagag
Q4V925_BAD-03      actgcgcgtcagatgagtcaatcgcccagctggttggcatttctttggagtcacaaagag
Q4V925_BAD-02      actgcgcgtcagatgagtcaatcgcccagctggttggcatttctttggagtcacaaagag
                   ** *  *  * ** **              *****  * ** ** ******* ****** 

E7FBJ6_BAD-01      ---gaagaggg---------cagagaatga
A7MCM4_BAD-01      tctgatgcggagtcgcgccccgcagagtga
Q4V925_BAD-01      tctgatgcggagtcgcgccccgcagagtga
Q4V925_BAD-04      tctgatgcggagtcgcgccccgcagagtga
Q4V925_BAD-03      tctgatgcggagtcgcgccccgcagagtga
Q4V925_BAD-02      tctgatgcggagtcgcgccccgcagagtga
                      ** * **          *  *** ***

© 1998-2018