Dataset for CDS classical BH3-containing proteins of organism Cynoglossus semilaevis

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P8UA78_BMF-01      atggatgacgaggaggacgatgtctttga----gccagacccgcacagct
A0A3P8UA78_BMF-03      atggatgacgaggaggacgatgtctttga----gccagacccgcacagct
A0A3P8UA78_BMF-02      atggatgacgaggaggacgatgtctttga----gccagacccgcacagct
A0A3P8WIZ8_BAD-02      atgaatgtagaagtgtccatctttccagatgtcacaatggctgcacagtt
A0A3P8WIZ8_BAD-01      ------------------------------------atggctgcacagtt
                                                           *   * ****** *

A0A3P8UA78_BMF-01      ggc--------acacaacattc----------agggagataaggtgtgaa
A0A3P8UA78_BMF-03      ggc--------acacaacattc----------agggagataaggtgtgaa
A0A3P8UA78_BMF-02      ggc--------acacaacattc----------agggagataaggtgtgaa
A0A3P8WIZ8_BAD-02      cactatatcggacagcgaatccgagccggaggaggaagtcgagggaggaa
A0A3P8WIZ8_BAD-01      cactatatcggacagcgaatccgagccggaggaggaagtcgagggaggaa
                         *        ***    ** *          *** **   ***   ***

A0A3P8UA78_BMF-01      gaccggggcacacagacacctggtccagacctgg--------cactga-a
A0A3P8UA78_BMF-03      gaccggggcacacagacacctggtccagacctgg--------cactga-a
A0A3P8UA78_BMF-02      gaccggggcacacagacacctggtccagacctgg--------cactga-a
A0A3P8WIZ8_BAD-02      aaattaagcattcattga-atgacccagaacaggttgtacctcaccggca
A0A3P8WIZ8_BAD-01      aaattaagcattcattga-atgacccagaacaggttgtacctcaccggca
                        *     ***  **   *  **  ***** * **        *** *  *

A0A3P8UA78_BMF-01      caacggcatgctgccctgtggggtgggagaggagcccagaccactcttct
A0A3P8UA78_BMF-03      caacggcatgctgccctgtggggtgggagaggagcccagaccactcttct
A0A3P8UA78_BMF-02      caacggcatgctgccctgtggggtgggagaggagcccagaccactcttct
A0A3P8WIZ8_BAD-02      caacctcaccctacct---------------gagctcagg----------
A0A3P8WIZ8_BAD-01      caacctcaccctacct---------------gagctcagg----------
                       ****  **  ** **                **** ***           

A0A3P8UA78_BMF-01      acggcaacgcaggctttcgattgcact---tcccagctcac---tttgag
A0A3P8UA78_BMF-03      acggcaacgcaggctttcgattgcact---tcccagctcac---tttgag
A0A3P8UA78_BMF-02      acggcaacgcaggctttcgattgcact---tcccagctcac---tttgag
A0A3P8WIZ8_BAD-02      gtggcag-gaagtcgtcggatcaggctaaattcagagtcacatgcttcaa
A0A3P8WIZ8_BAD-01      gtggcag-gaagtcgtcggatcaggctaaattcagagtcacatgcttcaa
                         ****  * ** * *  ***    **   * *    ****    ** * 

A0A3P8UA78_BMF-01      ctaattggagatcgggaaacaaggagaagacaaagtgacgaggagcgaaa
A0A3P8UA78_BMF-03      ctaattggagatcgggaaacaaggagaagacaaagtgacgaggagcgaaa
A0A3P8UA78_BMF-02      ctaattggagatcgggaaacaaggagaagacaaagtgacgaggagcgaaa
A0A3P8WIZ8_BAD-02      ccatttccaga---------gaggaagccttccagtcctgggggg-----
A0A3P8WIZ8_BAD-01      ccatttccaga---------gaggaagccttccagtcctgggggg-----
                       * * **  ***          ****        ***   * ** *     

A0A3P8UA78_BMF-01      taggatggagccgcggccccagcagcagcagcagc-agcagcggcagcag
A0A3P8UA78_BMF-03      taggatggagccgcggccccagcagcagcagcagc-agcagcggcagcag
A0A3P8UA78_BMF-02      taggatggagccgcggccccagcagcagcagcagc-agcagcggcagcag
A0A3P8WIZ8_BAD-02      -aggaagaagccggaacgcccacagaaggagctcctttcaggggacggtc
A0A3P8WIZ8_BAD-01      -aggaagaagccggaacgcccacagaaggagctcctttcaggggacggtc
                        **** * *****   * **  *** ** ***  *   *** **  *   

A0A3P8UA78_BMF-01      cag--cagcagcctgtgca----gcgcagcgtggaggtccgcattggcca
A0A3P8UA78_BMF-03      cag--cagcagcctgtgca----gcgcagcgtggaggtccgcattggcca
A0A3P8UA78_BMF-02      cag--cagcagcctgtgca----gcgcagcgtggaggtccgcattggcca
A0A3P8WIZ8_BAD-02      caggtcagctcctcctgccctgtgggcagcaaagaagta-----tggcag
A0A3P8WIZ8_BAD-01      caggtcagctcctcctgccctgtgggcagcaaagaagta-----tggcag
                       ***  ****  *   ***     * *****   ** **      ****  

A0A3P8UA78_BMF-01      gaaactccagctaataggagaccagttccaccgggatcatctgcagctgt
A0A3P8UA78_BMF-03      gaaactccagctaataggagaccagttccaccgggatcatctgcagctgt
A0A3P8UA78_BMF-02      gaaactccagctaataggagaccagttccaccgggatcatctgcagctgt
A0A3P8WIZ8_BAD-02      gcagctccgcaggatgagtgatgaatttgacag---------cctgctgg
A0A3P8WIZ8_BAD-01      gcagctccgcaggatgagtgatgaatttgacag---------cctgctgg
                       * * ****     **  * **  * **  ** *          * **** 

A0A3P8UA78_BMF-01      atcatcgaaaccaaaggaaccacgggccgctgtggtg--gcgcctgacca
A0A3P8UA78_BMF-03      atcatcgaaaccaaaggaaccacgggccgctgtggtg--gcgcctgacca
A0A3P8UA78_BMF-02      atcatcgaaaccaaaggaaccacgggccgctgtggtg--gcgcctgacca
A0A3P8WIZ8_BAD-02      a----------caaagggatgaggaa-------ggtgaagagcgcaggca
A0A3P8WIZ8_BAD-01      a----------caaagggatgaggaa-------ggtgaagagcgcaggca
                       *          ****** *  * *         ****  * **     **

A0A3P8UA78_BMF-01      caactctgctcagccttctgttcaacagagggt---------tcttt---
A0A3P8UA78_BMF-03      caactctgctcagccttctgttcaacagagggt---------tcttt---
A0A3P8UA78_BMF-02      caactctgctcagccttctgttcaacagagggt---------tcttt---
A0A3P8WIZ8_BAD-02      cagccagacagatgcaccactccaaaagctggtggagctacctctttagt
A0A3P8WIZ8_BAD-01      cagccagacagatgcaccactccaaaagctggtggagctacctctttagt
                       ** *    *  *  *  *  * *** **  ***         *****   

A0A3P8UA78_BMF-01      --------gctgg--------------------gggaggcgca---gcgg
A0A3P8UA78_BMF-03      --------gctgg--------------------gggaggcgca---gcgg
A0A3P8UA78_BMF-02      --------gctgg--------------------gggaggcgca---gcgg
A0A3P8WIZ8_BAD-02      caccaggagctggaaggagaaaacaaccatcacgagaaccacactcaccg
A0A3P8WIZ8_BAD-01      caccaggagctggaaggagaaaacaaccatcacgagaaccacactcaccg
                               *****                    * **  * **    * *

A0A3P8UA78_BMF-01      gacggaggtga
A0A3P8UA78_BMF-03      gacggaggtga
A0A3P8UA78_BMF-02      gacggaggtga
A0A3P8WIZ8_BAD-02      cactgagtag-
A0A3P8WIZ8_BAD-01      cactgagtag-
                        ** ***  * 

© 1998-2019