Dataset for CDS classical BH3-containing proteins of organism Colobus angolensis palliatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

17 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5J4Q7_BIK-01       atgt------------ctggagtaagacccatctccagagacatcttgat
A0A2K5JY52_PMAIP1-      atgc------------------------------------ctgggaagaa
A0A2K5JY52_PMAIP1-      atgc------------------------------------ctgggaagaa
A0A2K5HZI7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtg-----accgagaa
A0A2K5HZI7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtg-----accgagaa
A0A2K5HZI7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtg-----accgagaa
A0A2K5HZI7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtg-----accgagaa
A0A2K5HZI7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtg-----accgagaa
A0A2K5HZI7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtg-----accgagaa
A0A2K5HZI7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtg-----accgagaa
A0A2K5HZI7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtg-----accgagaa
A0A2K5HZI7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtg-----accgagaa
A0A2K5HZI7_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtg-----accgagaa
A0A2K5KGR6_BMF-01       atgg----------agcc-at-----ctcggtgtgtg-----gaggagct
A0A2K5KGR6_BMF-02       atgg----------agcc-at-----ctcggtgtgtg-----gaggagct
A0A2K5HKW9_BAD-02       atgt----------tccagat-----cccagagtttgagcctagtgagca
A0A2K5HKW9_BAD-01       atgt----------tccagat-----cccagagtttgagcctagtgagca
                        ***                                            *  

A0A2K5J4Q7_BIK-01       ggaga----------ccctcctgtatgagcagctcctggaacccctaacc
A0A2K5JY52_PMAIP1-      ggcgcgcaagaacgcgcaacc-------gag----------ccc---agc
A0A2K5JY52_PMAIP1-      ggcgcgcaagaacgcgcaacc-------gag----------ccc---agc
A0A2K5HZI7_BCL2L11      ggtagacaa----ttgcagcctgcg---gagaggcct---cccc---agc
A0A2K5HZI7_BCL2L11      ggtagacaa----ttgcagcctgcg---gagaggcct---cccc---agc
A0A2K5HZI7_BCL2L11      ggtagacaa----ttgcagcctgcg---gagaggcct---cccc---agc
A0A2K5HZI7_BCL2L11      ggtagacaa----ttgcagcctgcg---gagaggcct---cccc---agc
A0A2K5HZI7_BCL2L11      ggtagacaa----ttgcagcctgcg---gagaggcct---cccc---agc
A0A2K5HZI7_BCL2L11      ggtagacaa----ttgcagcctgcg---gagaggcct---cccc---agc
A0A2K5HZI7_BCL2L11      ggtagacaa----ttgcagcctgcg---gagaggcct---cccc---agc
A0A2K5HZI7_BCL2L11      ggtagacaa----ttgcagcctgcg---gagaggcct---cccc---agc
A0A2K5HZI7_BCL2L11      ggtagacaa----ttgcagcctgcg---gagaggcct---cccc---agc
A0A2K5HZI7_BCL2L11      ggtagacaa----ttgcagcctgcg---gagaggcct---cccc---agc
A0A2K5KGR6_BMF-01       ggaggatgacgtgttccagccggaggacggggagccgggggccc---aac
A0A2K5KGR6_BMF-02       ggaggatgacgtgttccagccggaggacggggagccgggggccc---aac
A0A2K5HKW9_BAD-02       ggaaga-------ctccagctctgcagagaggggcctgggcccc---agc
A0A2K5HKW9_BAD-01       ggaaga-------ctccagctctgcagagaggggcctgggcccc---agc
                        **              *  *        *            ***   * *

A0A2K5J4Q7_BIK-01       atggaggttcttggtgtga-------------------------------
A0A2K5JY52_PMAIP1-      gcgggct-------------------------------------------
A0A2K5JY52_PMAIP1-      gcgggct-------------------------------------------
A0A2K5HZI7_BCL2L11      t-------------------------------------------------
A0A2K5HZI7_BCL2L11      t-------------------------------------------------
A0A2K5HZI7_BCL2L11      t-------------------------------------------------
A0A2K5HZI7_BCL2L11      t-------------------------------------------------
A0A2K5HZI7_BCL2L11      t-------------------------------------------------
A0A2K5HZI7_BCL2L11      t-------------------------------------------------
A0A2K5HZI7_BCL2L11      t-------------------------------------------------
A0A2K5HZI7_BCL2L11      t-------------------------------------------------
A0A2K5HZI7_BCL2L11      t-------------------------------------------------
A0A2K5HZI7_BCL2L11      t-------------------------------------------------
A0A2K5KGR6_BMF-01       ccgggagctcgctctctgccgatctgtttgcccagagcttacttgactgc
A0A2K5KGR6_BMF-02       ccgggagctcgctctctgccgatctgtttgcccagagcttacttgactgc
A0A2K5HKW9_BAD-02       ccgg----------------------------caggg-------gacagg
A0A2K5HKW9_BAD-01       ccgg----------------------------caggg-------gacagg
                                                                          

A0A2K5J4Q7_BIK-01       --------ctgaccctgaaga--------------------ggacctgga
A0A2K5JY52_PMAIP1-      --------caggc----------------------------ag-------
A0A2K5JY52_PMAIP1-      --------caggc----------------------------aggtactga
A0A2K5HZI7_BCL2L11      --------cagac-------------------------ctggggccccta
A0A2K5HZI7_BCL2L11      --------cagac-------------------------ctggggccccta
A0A2K5HZI7_BCL2L11      --------cagac-------------------------ctggggccccta
A0A2K5HZI7_BCL2L11      --------cagac-------------------------ctggggccccta
A0A2K5HZI7_BCL2L11      --------cagac-------------------------ctggggccccta
A0A2K5HZI7_BCL2L11      --------cagac-------------------------ctggggccccta
A0A2K5HZI7_BCL2L11      --------cagac-------------------------ctggggccccta
A0A2K5HZI7_BCL2L11      --------cagac-------------------------ctggggccccta
A0A2K5HZI7_BCL2L11      --------cagac-------------------------ctggggccccta
A0A2K5HZI7_BCL2L11      --------cagac-------------------------ctggggccccta
A0A2K5KGR6_BMF-01       cccctcagccgacttcagctcttccctctcacccactgctgtggccctgg
A0A2K5KGR6_BMF-02       cccctcagccgacttcagctcttccctctcacccactgctgtggccctgg
A0A2K5HKW9_BAD-02       ccct----cagactccggcaagc--------atcatcgccaggccccagg
A0A2K5HKW9_BAD-01       ccct----cagactccggcaagc--------atcatcgccaggccccagg
                                * * *                             *       

A0A2K5J4Q7_BIK-01       ccctatggaggacttcgatcctttggagtgtatggaggacag--------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      cccgctggggccagcgaagacccaggctgggcgg----------------
A0A2K5HZI7_BCL2L11      cctcc-------ctacag---acagaaccacaag----------------
A0A2K5HZI7_BCL2L11      cctcc-------ctacag---acagaaccacaag----------------
A0A2K5HZI7_BCL2L11      cctcc-------ctacag---acagaaccacaag----------------
A0A2K5HZI7_BCL2L11      cctcc-------ctacag---acagaaccacaaggtaatcccgaaggcaa
A0A2K5HZI7_BCL2L11      cctcc-------ctacag---acagaaccacaaggtaatcccgaaggcaa
A0A2K5HZI7_BCL2L11      cctcc-------ctacag---acagaaccaca------------------
A0A2K5HZI7_BCL2L11      cctcc-------ctacag---acagaaccacaaggtaatcccgaaggcaa
A0A2K5HZI7_BCL2L11      cctcc-------ctacag---acagaaccacaaggtaatcccgaaggcaa
A0A2K5HZI7_BCL2L11      cctcc-------ctacag---acagaaccacaaggtaatcccgaaggcaa
A0A2K5HZI7_BCL2L11      cctcc-------ctacag---acagaaccacaaggtaatcccgaaggcaa
A0A2K5KGR6_BMF-01       ccttc---gacccaccag---ccaggaagacaaggctacccaga------
A0A2K5KGR6_BMF-02       ccttc---gacccaccag---ccaggaagacaaggctacccaga------
A0A2K5HKW9_BAD-02       cctcctgtgggacgccagtcaccagcaggagcaggcaaccag--------
A0A2K5HKW9_BAD-01       cctcctgtgggacgccagtcaccagcaggagcaggcaaccag--------
                                                                          

A0A2K5J4Q7_BIK-01       ----------tgacatgttggccctgcggctggcctgcatcggggatgag
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      ------------------------------ggtcggggccggggcaaaa-
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      tcacggaggtgaaggggacagctgcccccacggcagccctcagggcccg-
A0A2K5HZI7_BCL2L11      tcacggaggtgaaggggacagctgcccccacggcagccctcagggcccg-
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      tcacggaggtgaaggggacagctgcccccacggcagccctcagggcccg-
A0A2K5HZI7_BCL2L11      tcacggaggtgaaggggacagctgcccccacggcagccctcagggcccg-
A0A2K5HZI7_BCL2L11      tcacggaggtgaaggggacagctgcccccacggcagccctcagggcccg-
A0A2K5HZI7_BCL2L11      tcacggaggtgaaggggacagctgcccccacggcagccctcagggcccg-
A0A2K5KGR6_BMF-01       ---------------------ccctcggcccagcctcccccagccaagg-
A0A2K5KGR6_BMF-02       ---------------------ccctcggcccagcctcccccagccaagg-
A0A2K5HKW9_BAD-02       ------------------------------cagcagccatcatggaggg-
A0A2K5HKW9_BAD-01       ------------------------------cagcagccatca--------
                                                                          

A0A2K5J4Q7_BIK-01       atggacgtgagcctcagggccccgcgcctggcccagctctctgaggtggc
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      ---------------agctcctctcctccccacttgcccttccgcggggc
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      ---------------ctggccccaccggccagccctggcccttttgctac
A0A2K5HZI7_BCL2L11      ---------------ctggccccaccggccagccctggcccttttgctac
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      ---------------ctggccccaccggccagccctggcccttttgctac
A0A2K5HZI7_BCL2L11      ---------------ctggccccaccggccagccctggcccttttgctac
A0A2K5HZI7_BCL2L11      ---------------ctggccccaccggccagccctggcccttttgctac
A0A2K5HZI7_BCL2L11      ---------------ctggccccaccggccagccctggcccttttgctac
A0A2K5KGR6_BMF-01       ---------------------tgtcatgctgcct-----tgtggggtaac
A0A2K5KGR6_BMF-02       ---------------------tgtcatgctgcct-----tgtggggtaac
A0A2K5HKW9_BAD-02       ---------------agagcttggtattctccttctgaatctgaggactc
A0A2K5HKW9_BAD-01       --------------------------------------------------
                                                                          

A0A2K5J4Q7_BIK-01       catgcacagcctgggtctggctttcatcta--------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      cacgaggaacaag-------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      c---agatccccgcttttcatctttatgagaagatcctccctgctgtctc
A0A2K5HZI7_BCL2L11      c---agatccccgcttttcatctttatgagaagatcctccctgctgtctc
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      c---agatccccgcttttcatctttatgagaagatcctccctgctgtctc
A0A2K5HZI7_BCL2L11      c---agatccccgcttttcatctttatgagaagatcctccctgctgtctc
A0A2K5HZI7_BCL2L11      c---agatccccgcttttcatctttatgagaagatcctccctgctgtctc
A0A2K5HZI7_BCL2L11      c---agatccccgcttttcatctttatgagaagatcctccctgctgtctc
A0A2K5KGR6_BMF-01       tgaggaaccccagcgactgttttatg------------------------
A0A2K5KGR6_BMF-02       tgaggaaccccagcgactgttttatggcaatgctggctaccggcttcctc
A0A2K5HKW9_BAD-02       tgaaaatcccagtgcaaggatgctcacggaagcatcagcagggatgtctg
A0A2K5HKW9_BAD-01       --------------------------------------------------
                                                                          

A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      gatcctccagtgggtatttctcttttgacac-------------------
A0A2K5HZI7_BCL2L11      gatcctccagtgggtatttctcttttgacac-------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      gatcctccagtgggtatttctcttttgacac-------------------
A0A2K5HZI7_BCL2L11      gatcctccagtgggtatttctcttttgacac-------------------
A0A2K5HZI7_BCL2L11      gatcctccagtgggtatttctcttttgacac-------------------
A0A2K5HZI7_BCL2L11      gatcctccagtgggtatttctcttttgacac-------------------
A0A2K5KGR6_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-02       tccctgccagtttcccggcagtcttgcccatcggggagcagccccccgaa
A0A2K5HKW9_BAD-02       ccccagccactgactcagaagcccaacacgcagagaatgtaaagctggag
A0A2K5HKW9_BAD-01       ---------------------------------------------tggag
                                                                          

A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5KGR6_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-02       gggcagtggcaacatcgagcagaggtacagattgcccgaaagcttcagtg
A0A2K5HKW9_BAD-02       gcgctggggctgtggagacccggagt------------------------
A0A2K5HKW9_BAD-01       gcgctggggctgtggagacccggagt------------------------
                                                                          

A0A2K5J4Q7_BIK-01       -------------------------------------cgaccagaccgac
A0A2K5JY52_PMAIP1-      --------------------------------------------agctc-
A0A2K5JY52_PMAIP1-      -------------------------------------tgcaagtagctc-
A0A2K5HZI7_BCL2L11      ---------------------------------------acaggagccca
A0A2K5HZI7_BCL2L11      ---------------------------------------acaggagccca
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      -------------------------------------agacaggagccca
A0A2K5HZI7_BCL2L11      -------------------------------------agacaggagccca
A0A2K5HZI7_BCL2L11      -------------------------------------agacaggagccca
A0A2K5HZI7_BCL2L11      -------------------------------------agacaggagccca
A0A2K5HZI7_BCL2L11      -------------------------------------agacaggagccca
A0A2K5HZI7_BCL2L11      -------------------------------------agacaggagccca
A0A2K5HZI7_BCL2L11      -------------------------------------agacaggagccca
A0A2K5KGR6_BMF-01       -------------------------------------caccagcagaacc
A0A2K5KGR6_BMF-02       cattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaacc
A0A2K5HKW9_BAD-02       -------------------------------------cgcca-cagctcc
A0A2K5HKW9_BAD-01       -------------------------------------cgcca-cagctcc
                                                                          

A0A2K5J4Q7_BIK-01       gacatcagggatgt-----------------tcttagaagttt-------
A0A2K5JY52_PMAIP1-      gaagtcgagtgtgctactcaactcaggagatttggagacaaac----tga
A0A2K5JY52_PMAIP1-      gaagtcgagtgtgctactcaactcaggagatttggagacaaac----tga
A0A2K5HZI7_BCL2L11      gcacccatgag--------------------ttgtgacaaatcaacacaa
A0A2K5HZI7_BCL2L11      gcacccatgag--------------------ttgtgacaaatcaacacaa
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      gcacccatgag--------------------ttgtgacaaatcaacacaa
A0A2K5HZI7_BCL2L11      gcacccatgag--------------------ttgtgacaaatcaacacaa
A0A2K5HZI7_BCL2L11      gcacccatgag--------------------ttgtgacaaatcaacacaa
A0A2K5HZI7_BCL2L11      gcacccatgag--------------------ttgtgacaaatcaacacaa
A0A2K5HZI7_BCL2L11      gcacccatgag--------------------ttgtgacaaatcaacacaa
A0A2K5HZI7_BCL2L11      gcacccatgag--------------------ttgtgacaaatcaacacaa
A0A2K5HZI7_BCL2L11      gcacccatgag--------------------ttgtgacaaatcaacacaa
A0A2K5KGR6_BMF-01       gaaatcgcgtg--------------------tggtggcagatc----ct-
A0A2K5KGR6_BMF-02       gaaatcgcgtg--------------------tggtggcagatc----ct-
A0A2K5HKW9_BAD-02       caccccgcggggacggaggaggacgaagggatggaggaggagc----cca
A0A2K5HKW9_BAD-01       caccccgcggggacggaggaggacgaagggatggaggaggagc----cca
                                                                          

A0A2K5J4Q7_BIK-01       -----------------------catggacggcttcaccacccttaa-gg
A0A2K5JY52_PMAIP1-      acttccggcagaaacttctga--atctgatagccaaactcttctgctcag
A0A2K5JY52_PMAIP1-      acttccggcagaaacttctga--atctgatagccaaactcttctgctcag
A0A2K5HZI7_BCL2L11      accccaag---------------tcctccttgccaggc---cttcaacca
A0A2K5HZI7_BCL2L11      accccaag---------------tcctccttgccaggc---cttcaacca
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      accccaag---------------tcctccttgccaggc---cttcaacca
A0A2K5HZI7_BCL2L11      accccaag---------------tcctccttgccaggc---cttcaacca
A0A2K5HZI7_BCL2L11      accccaag---------------tcctccttgccaggc---cttcaacca
A0A2K5HZI7_BCL2L11      accccaag---------------tcctccttgccaggc---cttcaacca
A0A2K5HZI7_BCL2L11      accccaag---------------tcctccttgccaggc---cttcaacca
A0A2K5HZI7_BCL2L11      accccaag---------------tcctccttgccaggc---cttcaacca
A0A2K5HZI7_BCL2L11      accccaag---------------tcctccttgccaggc---cttcaacca
A0A2K5KGR6_BMF-01       -cctctt----------------cctgcacaaccttgc---tttgaatgg
A0A2K5KGR6_BMF-02       -cctctt----------------cctgcacaaccttgc---tttgaatgg
A0A2K5HKW9_BAD-02       gcccctttcggggccgctcgcgctccgcgccccctaac---ctc---tgg
A0A2K5HKW9_BAD-01       gcccctttcggggccgctcgcgctccgcgccccctaac---ctc---tgg
                                                                          

A0A2K5J4Q7_BIK-01       agaacataatgaggttctggagatccccgaatcccgggtcccgggtgtcc
A0A2K5JY52_PMAIP1-      gaacctga------------------------------------------
A0A2K5JY52_PMAIP1-      gaacctgactgcaacaaaaa-------cttgcatgaggggactccaaaag
A0A2K5HZI7_BCL2L11      ctatctcagtgcaatggtag-------tcatcctagaggatataggtgat
A0A2K5HZI7_BCL2L11      ctatctcagtgcaatgga------------t-----gaggcc-actggat
A0A2K5HZI7_BCL2L11      -----------------c------------ttccaggaggca-ggctgaa
A0A2K5HZI7_BCL2L11      ctatctcagtgcaatggt------------t-------------------
A0A2K5HZI7_BCL2L11      ctatctcagtgcaat-----------------------------------
A0A2K5HZI7_BCL2L11      ctatctcagtgcaatggc------------ttccaggaggca-ggctgaa
A0A2K5HZI7_BCL2L11      ctatctcagtgcaatggc------------ttccaggaggca-ggctgaa
A0A2K5HZI7_BCL2L11      ctatctcagtgcaatggc------------ttccaggaggca-ggctgaa
A0A2K5HZI7_BCL2L11      ctatctcagtgcaatggc------------ttccaggaggca-ggctgaa
A0A2K5HZI7_BCL2L11      ctatctcagtgcaatggc------------taactgg-------------
A0A2K5KGR6_BMF-01       agaagagaacaggaacgggg-------cgggccccaggtgaggctgggc-
A0A2K5KGR6_BMF-02       agaagagaacaggaacgggg-------cgggccccaggtga---------
A0A2K5HKW9_BAD-02       gcagcacagcgatatggccg-------cgagctccggaggatga------
A0A2K5HKW9_BAD-01       gcagcacagcgatatggccg-------cgagctccggaggatgagtgacg
                                                                          

A0A2K5J4Q7_BIK-01       cgcgaacaggtgctgctggcgctgctgctgctgctggcactgctgctggc
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      agaatttttctcaggaggtgcacatttcatcaatttgaagcaagattgca
A0A2K5HZI7_BCL2L11      acttcattgtggtttggatttatatttactggcttagatttgtatggcca
A0A2K5HZI7_BCL2L11      cct---------------------------ccctcagaattgc-------
A0A2K5HZI7_BCL2L11      cctgcagatatgcgcccggagatacggatcgcccaagagttgcggcg---
A0A2K5HZI7_BCL2L11      -----------------agagaaatag-----------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      cctgcagatatgcgcccggagatacggatcgcccaagagttgcggcg---
A0A2K5HZI7_BCL2L11      cctgcagatatgcgcccggagatacggatcgcccaagagttgcggcg---
A0A2K5HZI7_BCL2L11      cctgcagatatgcgcccggagatacggatcgcccaagagttgcggcg---
A0A2K5HZI7_BCL2L11      cctgcagatatgcgcccggagatacggatcgcccaagagttgcggcg---
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5KGR6_BMF-01       ------tgccctcttcacatggggcaccaggaacaccgtcaggaaggaca
A0A2K5KGR6_BMF-02       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       agtttgtggactcttttaagggacttcctcgcccgaagagcgcgggcaca
                                                                          

A0A2K5J4Q7_BIK-01       gctgctcagcgggggcctgcacctgctgctcaagtga-------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      ttgtaat-------------------------------------------
A0A2K5HZI7_BCL2L11      ccaccacagtcaagatacagaacaactcaaccacagggatttc-------
A0A2K5HZI7_BCL2L11      ------------------------ccttcatagggaagtt----------
A0A2K5HZI7_BCL2L11      -aatcggagacgagtttaacgcttactatgcaaggaggttg---------
A0A2K5HZI7_BCL2L11      --------------------------------aggaagttgtc-------
A0A2K5HZI7_BCL2L11      ------------------------------------gggtgttttt----
A0A2K5HZI7_BCL2L11      -aatcggagacgagtttaacgcttactatgcaaggagggtgttttt----
A0A2K5HZI7_BCL2L11      -aatcggagacgagtttaacgcttactatgcaaggagggtgttttt----
A0A2K5HZI7_BCL2L11      -aatcggagacgagtttaacgcttactatgcaaggaggtt---------a
A0A2K5HZI7_BCL2L11      -aatcggagacgagtttaacgcttactatgcaaggaggatgtctcttcca
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5KGR6_BMF-01       tcgggcaggactgacactgtgtcttgtgaagttgtttttttgttgttatt
A0A2K5KGR6_BMF-02       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       gcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctg
                                                                          

A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5HZI7_BCL2L11      ---tcatga-----------------------------------------
A0A2K5HZI7_BCL2L11      ---cagtag-----------------------------------------
A0A2K5HZI7_BCL2L11      ---gcaaaa-----------------------------------------
A0A2K5HZI7_BCL2L11      ---gtgtag-----------------------------------------
A0A2K5HZI7_BCL2L11      ---gaataa-----------------------------------------
A0A2K5HZI7_BCL2L11      ---gaataattaccaagcagccgaagaccacccacaaatggttatcttac
A0A2K5HZI7_BCL2L11      ---gaataattaccaagcagccgaagaccacccacaaatggttatcttac
A0A2K5HZI7_BCL2L11      gagaaatag-----------------------------------------
A0A2K5HZI7_BCL2L11      cctgattaa-----------------------------------------
A0A2K5HZI7_BCL2L11      ---gactag-----------------------------------------
A0A2K5KGR6_BMF-01       ttgcgttttaa---------------------------------------
A0A2K5KGR6_BMF-02       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       gtgggatcggaacttgggcaggggaagctccgccccctcccagtga----
                                                                          

A0A2K5J4Q7_BIK-01       --------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------
A0A2K5HZI7_BCL2L11      ------ctcctggcatcctccacctga-----------------
A0A2K5HZI7_BCL2L11      --------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------
A0A2K5HZI7_BCL2L11      gactgttgcgttacattgtccgcctggtgtggagaatgcattga
A0A2K5HZI7_BCL2L11      gactgttgcgttacattgtccgcctggtgtggagaatgcattga
A0A2K5HZI7_BCL2L11      --------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------
A0A2K5KGR6_BMF-01       --------------------------------------------
A0A2K5KGR6_BMF-02       --------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------
A0A2K5HKW9_BAD-01       --------------------------------------------
                                                                    

© 1998-2019