Dataset for CDS BMF of organism Colobus angolensis palliatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5KGR6_BMF-01      atggagccatctcggtgtgtggaggagctggaggatgacgtgttccagcc
A0A2K5KGR6_BMF-02      atggagccatctcggtgtgtggaggagctggaggatgacgtgttccagcc

A0A2K5KGR6_BMF-01      ggaggacggggagccgggggcccaacccgggagctcgctctctgccgatc
A0A2K5KGR6_BMF-02      ggaggacggggagccgggggcccaacccgggagctcgctctctgccgatc

A0A2K5KGR6_BMF-01      tgtttgcccagagcttacttgactgccccctcagccgacttcagctcttc
A0A2K5KGR6_BMF-02      tgtttgcccagagcttacttgactgccccctcagccgacttcagctcttc

A0A2K5KGR6_BMF-01      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A2K5KGR6_BMF-02      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga

A0A2K5KGR6_BMF-01      caaggctacccagaccctcggcccagcctcccccagccaaggtgtcatgc
A0A2K5KGR6_BMF-02      caaggctacccagaccctcggcccagcctcccccagccaaggtgtcatgc

A0A2K5KGR6_BMF-01      tgccttgtggggtaactgaggaaccccagcgactgttttatg--------
A0A2K5KGR6_BMF-02      tgccttgtggggtaactgaggaaccccagcgactgttttatggcaatgct

A0A2K5KGR6_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-02      ggctaccggcttcctctccctgccagtttcccggcagtcttgcccatcgg

A0A2K5KGR6_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-02      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg

A0A2K5KGR6_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-02      cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcag

A0A2K5KGR6_BMF-01      ---caccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct
A0A2K5KGR6_BMF-02      caacaccagcagaaccgaaatcgcgtgtggtggcagatcctcctcttcct

A0A2K5KGR6_BMF-01      gcacaaccttgctttgaatggagaagagaacaggaacggggcgggcccca
A0A2K5KGR6_BMF-02      gcacaaccttgctttgaatggagaagagaacaggaacggggcgggcccca

A0A2K5KGR6_BMF-01      ggtgaggctgggctgccctcttcacatggggcaccaggaacaccgtcagg
A0A2K5KGR6_BMF-02      ggtga---------------------------------------------

A0A2K5KGR6_BMF-01      aaggacatcgggcaggactgacactgtgtcttgtgaagttgtttttttgt
A0A2K5KGR6_BMF-02      --------------------------------------------------

A0A2K5KGR6_BMF-01      tgttattttgcgttttaa
A0A2K5KGR6_BMF-02      ------------------

© 1998-2019