Dataset for CDS BAD of organism Colobus angolensis palliatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5HKW9_BAD-02      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
A0A2K5HKW9_BAD-01      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc

A0A2K5HKW9_BAD-02      tgcagagaggggcctgggccccagcccggcaggggacaggccctcagact
A0A2K5HKW9_BAD-01      tgcagagaggggcctgggccccagcccggcaggggacaggccctcagact

A0A2K5HKW9_BAD-02      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2K5HKW9_BAD-01      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac

A0A2K5HKW9_BAD-02      cagcaggagcaggcaaccagcagcagccatcatggagggagagcttggta
A0A2K5HKW9_BAD-01      cagcaggagcaggcaaccagcagcagccatca------------------

A0A2K5HKW9_BAD-02      ttctccttctgaatctgaggactctgaaaatcccagtgcaaggatgctca
A0A2K5HKW9_BAD-01      --------------------------------------------------

A0A2K5HKW9_BAD-02      cggaagcatcagcagggatgtctgccccagccactgactcagaagcccaa
A0A2K5HKW9_BAD-01      --------------------------------------------------

A0A2K5HKW9_BAD-02      cacgcagagaatgtaaagctggaggcgctggggctgtggagacccggagt
A0A2K5HKW9_BAD-01      -------------------tggaggcgctggggctgtggagacccggagt

A0A2K5HKW9_BAD-02      cgccacagctcccaccccgcggggacggaggaggacgaagggatggagga
A0A2K5HKW9_BAD-01      cgccacagctcccaccccgcggggacggaggaggacgaagggatggagga

A0A2K5HKW9_BAD-02      ggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctct
A0A2K5HKW9_BAD-01      ggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctct

A0A2K5HKW9_BAD-02      gggcagcacagcgatatggccgcgagctccggaggatga-----------
A0A2K5HKW9_BAD-01      gggcagcacagcgatatggccgcgagctccggaggatgagtgacgagttt

A0A2K5HKW9_BAD-02      --------------------------------------------------
A0A2K5HKW9_BAD-01      gtggactcttttaagggacttcctcgcccgaagagcgcgggcacagcgac

A0A2K5HKW9_BAD-02      --------------------------------------------------
A0A2K5HKW9_BAD-01      gcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtggg

A0A2K5HKW9_BAD-02      -----------------------------------------
A0A2K5HKW9_BAD-01      atcggaacttgggcaggggaagctccgccccctcccagtga

© 1998-2019