Dataset for CDS classical BH3-containing proteins of organism Cercocebus atys

[Download (right click)] [Edit] [Sequences] [Repertoires]

19 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5NJZ2_PMAIP1-      atgc------------ctg--------------------ggaagaaggcg
A0A2K5LDM6_BIK-01       atgt------------ctggagtaagacccatctccagagacacctggat
A0A2K5KZ69_HRK-01       atgt-----------------gcccgtgccccct-----gca--------
A0A2K5NU92_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagt-----gtgaccgagaa
A0A2K5NU92_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagt-----gtgaccgagaa
A0A2K5NU92_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagt-----gtgaccgagaa
A0A2K5NU92_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagt-----gtgaccgagaa
A0A2K5NU92_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagt-----gtgaccgagaa
A0A2K5NU92_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagt-----gtgaccgagaa
A0A2K5NU92_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagt-----gtgaccgagaa
A0A2K5NU92_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagt-----gtgaccgagaa
A0A2K5NU92_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagt-----gtgaccgagaa
A0A2K5NU92_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagt-----gtgaccgagaa
A0A2K5M0C1_BAD-02       atgttccag--a--tcccagagtttgagcctagt-----g--agcaggaa
A0A2K5M0C1_BAD-03       atgttccag--a--tcccagagtttgagcctagt-----g--agcaggaa
A0A2K5M0C1_BAD-01       atgttccag--a--tcccagagtttgagcctagt-----g--agcaggaa
A0A2K5P2T8_BBC3-03      ataa---aa------tttggcgtggggtctgccc-----g------ggca
A0A2K5MJY6_BMF-02       atgg---agcca--tctcggtgtgtggaggagct-----ggaggatgatg
A0A2K5MJY6_BMF-01       atgg---agcca--tctcggtgtgtggaggagct-----ggaggatgatg
                        **                                     *          

A0A2K5NJZ2_PMAIP1-      cgcaagaacgcgcaacc-----------------gagcccaatg---cgg
A0A2K5LDM6_BIK-01       ggagacc--ctcctgta----tgagcagctcctggaacccctaaccatgg
A0A2K5KZ69_HRK-01       ---------ccgcggcc-------gcggccccccggccgtgtgcgactgc
A0A2K5NU92_BCL2L11      ggtagacaattgcagcc-tgcggagaggcctccccagctcagac---ctg
A0A2K5NU92_BCL2L11      ggtagacaattgcagcc-tgcggagaggcctccccagctcagac---ctg
A0A2K5NU92_BCL2L11      ggtagacaattgcagcc-tgcggagaggcctccccagctcagac---ctg
A0A2K5NU92_BCL2L11      ggtagacaattgcagcc-tgcggagaggcctccccagctcagac---ctg
A0A2K5NU92_BCL2L11      ggtagacaattgcagcc-tgcggagaggcctccccagctcagac---ctg
A0A2K5NU92_BCL2L11      ggtagacaattgcagcc-tgcggagaggcctccccagctcagac---ctg
A0A2K5NU92_BCL2L11      ggtagacaattgcagcc-tgcggagaggcctccccagctcagac---ctg
A0A2K5NU92_BCL2L11      ggtagacaattgcagcc-tgcggagaggcctccccagctcagac---ctg
A0A2K5NU92_BCL2L11      ggtagacaattgcagcc-tgcggagaggcctccccagctcagac---ctg
A0A2K5NU92_BCL2L11      ggtagacaattgcagcc-tgcggagaggcctccccagctcagac---ctg
A0A2K5M0C1_BAD-02       ga-------ctccagctctgcagagaggggcctgggccccagtctcgcgg
A0A2K5M0C1_BAD-03       ga-------ctccagctctgcagagaggggcctgggccccagtctcgcgg
A0A2K5M0C1_BAD-01       ga-------ctccagctctgcagagaggggcctgggccccagtctcgcgg
A0A2K5P2T8_BBC3-03      tg-------tccatgcc--------aggtgcccagggctgcttc---tgc
A0A2K5MJY6_BMF-02       tg-------ttccagccggaggacggggagccaggggcccaacc---cgg
A0A2K5MJY6_BMF-01       tg-------ttccagccggaggacggggagccaggggcccaacc---cgg
                                                             *            

A0A2K5NJZ2_PMAIP1-      g---------ctc-------------------------------------
A0A2K5LDM6_BIK-01       ag-----gttctt----ggtgtgactgaccctgaagaggacc--------
A0A2K5KZ69_HRK-01       agcgcgggtcgtttggggctgcgctcgtccgccgcgcagctcac------
A0A2K5NU92_BCL2L11      gggcccctacctc--------------cctacagacagagccacaag---
A0A2K5NU92_BCL2L11      gggcccctacctc--------------cctacagacagagccacaag---
A0A2K5NU92_BCL2L11      gggcccctacctc--------------cctacagacagagccacaag---
A0A2K5NU92_BCL2L11      gggcccctacctc--------------cctacagacagagccacaaggta
A0A2K5NU92_BCL2L11      gggcccctacctc--------------cctacagacagagccacaaggta
A0A2K5NU92_BCL2L11      gggcccctacctc--------------cctacagacagagccacaaggta
A0A2K5NU92_BCL2L11      gggcccctacctc--------------cctacagacagagccaca-----
A0A2K5NU92_BCL2L11      gggcccctacctc--------------cctacagacagagccacaaggta
A0A2K5NU92_BCL2L11      gggcccctacctc--------------cctacagacagagccacaaggta
A0A2K5NU92_BCL2L11      gggcccctacctc--------------cctacagacagagccacaaggta
A0A2K5M0C1_BAD-02       gggacaggccctc------------agactgcggcaagcatcat------
A0A2K5M0C1_BAD-03       gggacaggccctc------------agactgcggcaagcatcat------
A0A2K5M0C1_BAD-01       gggacaggccctc------------agactgcggcaagcatcat------
A0A2K5P2T8_BBC3-03      gacgtgggtcctctgccagatttgtggtcctcagccctcgctct------
A0A2K5MJY6_BMF-02       ga-gctcgctctctgccgatctgtttgcccagagcctacttgac------
A0A2K5MJY6_BMF-01       ga-gctcgctctctgccgatctgtttgcccagagcctacttgac------
                                   *                                      

A0A2K5NJZ2_PMAIP1-      -------------------------------------------aggcaga
A0A2K5LDM6_BIK-01       -----------------------------------tggaccctatggagg
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      atcccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagc
A0A2K5NU92_BCL2L11      atcccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagc
A0A2K5NU92_BCL2L11      atcccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagc
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      atcccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagc
A0A2K5NU92_BCL2L11      atcccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagc
A0A2K5NU92_BCL2L11      atcccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagc
A0A2K5M0C1_BAD-02       -----------------------------------cgccag---------
A0A2K5M0C1_BAD-03       -----------------------------------cgccag---------
A0A2K5M0C1_BAD-01       -----------------------------------cgccag---------
A0A2K5P2T8_BBC3-03      -----------------------------------tgctggcggagcagc
A0A2K5MJY6_BMF-02       -----------------------------------tgccccctcagccg-
A0A2K5MJY6_BMF-01       -----------------------------------tgccccctcagccg-
                                                                          

A0A2K5NJZ2_PMAIP1-      gctcgaagtcgagtgtgctactcaact-----------------------
A0A2K5LDM6_BIK-01       acttcgatcctttggagtgtatgg--------------------------
A0A2K5KZ69_HRK-01       ------cgccgcccggctca------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      cctcagggcccgctggccccaccggccagccctggcccttttgctaccag
A0A2K5NU92_BCL2L11      cctcagggcccgctggccccaccggccagccctggcccttttgctaccag
A0A2K5NU92_BCL2L11      cctcagggcccgctggccccaccggccagccctggcccttttgctaccag
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      cctcagggcccgctggccccaccggccagccctggcccttttgctaccag
A0A2K5NU92_BCL2L11      cctcagggcccgctggccccaccggccagccctggcccttttgctaccag
A0A2K5NU92_BCL2L11      cctcagggcccgctggccccaccggccagccctggcccttttgctaccag
A0A2K5M0C1_BAD-02       gccccaggcctcctgt----------------------------------
A0A2K5M0C1_BAD-03       gccccaggcctcctgt----------------------------------
A0A2K5M0C1_BAD-01       gccccaggcctcctgt----------------------------------
A0A2K5P2T8_BBC3-03      acctggagtcgcccgtgcccagcgccc-----------------------
A0A2K5MJY6_BMF-02       acttcagctcttccctctcacccactg-----------------------
A0A2K5MJY6_BMF-01       acttcagctcttccctctcacccactg-----------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      atccccgcttttcatctttatgagaagatcctccctgctgtctcgatcct
A0A2K5NU92_BCL2L11      atccccgcttttcatctttatgagaagatcctccctgctgtctcgatcct
A0A2K5NU92_BCL2L11      atccccgcttttcatctttatgagaagatcctccctgctgtctcgatcct
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      atccccgcttttcatctttatgagaagatcctccctgctgtctcgatcct
A0A2K5NU92_BCL2L11      atccccgcttttcatctttatgagaagatcctccctgctgtctcgatcct
A0A2K5NU92_BCL2L11      atccccgcttttcatctttatgagaagatcctccctgctgtctcgatcct
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5MJY6_BMF-02       --------------------------------------------------
A0A2K5MJY6_BMF-01       --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      ---------------------------caggagatttggagacaaac---
A0A2K5LDM6_BIK-01       -----------------------------aggacagtgacatgttggccc
A0A2K5KZ69_HRK-01       -----------------------------aggcgcttggcgacgagctgc
A0A2K5NU92_BCL2L11      ---------------------------acaggagcccagcacccatgagt
A0A2K5NU92_BCL2L11      ---------------------------acaggagcccagcacccatgagt
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      ccagtgggtatttctcttttgacacagacaggagcccagcacccatgagt
A0A2K5NU92_BCL2L11      ccagtgggtatttctcttttgacacagacaggagcccagcacccatgagt
A0A2K5NU92_BCL2L11      ccagtgggtatttctcttttgacacagacaggagcccagcacccatgagt
A0A2K5NU92_BCL2L11      -------------------------agacaggagcccagcacccatgagt
A0A2K5NU92_BCL2L11      ccagtgggtatttctcttttgacacagacaggagcccagcacccatgagt
A0A2K5NU92_BCL2L11      ccagtgggtatttctcttttgacacagacaggagcccagcacccatgagt
A0A2K5NU92_BCL2L11      ccagtgggtatttctcttttgacacagacaggagcccagcacccatgagt
A0A2K5M0C1_BAD-02       -----------------------------gggacgccagtcaccagcagg
A0A2K5M0C1_BAD-03       -----------------------------gggacgccagtcaccagcagg
A0A2K5M0C1_BAD-01       -----------------------------gggacgccagtcaccagcagg
A0A2K5P2T8_BBC3-03      ---------------------------cgggggccctggcgggcggt---
A0A2K5MJY6_BMF-02       ---------------------------ctgtggccctggccttcgac---
A0A2K5MJY6_BMF-01       ---------------------------ctgtggccctggccttcgac---
                                                                          

A0A2K5NJZ2_PMAIP1-      --tgaacttccggcagaaacttc---------------------------
A0A2K5LDM6_BIK-01       tgcggctggcctgcatcgg-------------------------------
A0A2K5KZ69_HRK-01       accagcgcacca--------------------------------------
A0A2K5NU92_BCL2L11      tgtgacaaatcaacacaaacccc---------------------------
A0A2K5NU92_BCL2L11      tgtgacaaatcaacacaaacccc---------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      tgtgacaaatcaacacaaacccc---------------------------
A0A2K5NU92_BCL2L11      tgtgacaaatcaacacaaacccc---------------------------
A0A2K5NU92_BCL2L11      tgtgacaaatcaacacaaacccc---------------------------
A0A2K5NU92_BCL2L11      tgtgacaaatcaacacaaacccc---------------------------
A0A2K5NU92_BCL2L11      tgtgacaaatcaacacaaacccc---------------------------
A0A2K5NU92_BCL2L11      tgtgacaaatcaacacaaacccc---------------------------
A0A2K5NU92_BCL2L11      tgtgacaaatcaacacaaacccc---------------------------
A0A2K5M0C1_BAD-02       agcagccaaccagcagcagccatcatggaggg------------------
A0A2K5M0C1_BAD-03       agcagccaaccagcagcagccatcatggagggggagcttggtattctcct
A0A2K5M0C1_BAD-01       agcagccaaccagcagcagccatcatgg----------------------
A0A2K5P2T8_BBC3-03      --c--ccacccag-------------------------------------
A0A2K5MJY6_BMF-02       --ccaccagccag-------------------------------------
A0A2K5MJY6_BMF-01       --ccaccagccag-------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-03       tcttgggaatctgaggactctgaaaatcccagtgcaaggatgctcgcgga
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5MJY6_BMF-02       --------------------------------------------------
A0A2K5MJY6_BMF-01       --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5M0C1_BAD-02       ---------------------------------------acttcctcgcc
A0A2K5M0C1_BAD-03       agcatcagcacggatgtctgccccagccactgactcagaagcccaacacg
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5MJY6_BMF-02       --------------------------------------------------
A0A2K5MJY6_BMF-01       --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      -----------------------------------tgaatctgatagcca
A0A2K5LDM6_BIK-01       --------------------ggacgagatggatgtgagcctcagggcccc
A0A2K5KZ69_HRK-01       --------tgtggcggcgccgcgcgcggagccggagggcgccggcgcccg
A0A2K5NU92_BCL2L11      -----------------------------------aagtcctccttgcca
A0A2K5NU92_BCL2L11      -----------------------------------aagtcctccttgcca
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      -----------------------------------aagtcctccttgcca
A0A2K5NU92_BCL2L11      -----------------------------------aagtcctccttgcca
A0A2K5NU92_BCL2L11      -----------------------------------aagtcctccttgcca
A0A2K5NU92_BCL2L11      -----------------------------------aagtcctccttgcca
A0A2K5NU92_BCL2L11      -----------------------------------aagtcctccttgcca
A0A2K5NU92_BCL2L11      -----------------------------------aagtcctccttgcca
A0A2K5NU92_BCL2L11      -----------------------------------aagtcctccttgcca
A0A2K5M0C1_BAD-02       cgaagagcgcgggcacagcgacgcagatgcggcaaagctccagctggacg
A0A2K5M0C1_BAD-03       cagagaatgtaaagctgaaggcgctggggctgtggagacccgg--agtcg
A0A2K5M0C1_BAD-01       ------------------aggcgctggggctgtggagacccgg--agtcg
A0A2K5P2T8_BBC3-03      --------gcggccccgggagtccgcggggaggaggaacagtg--ggccc
A0A2K5MJY6_BMF-02       --------gaagacaaggccaccc-----------agaccctc--ggccc
A0A2K5MJY6_BMF-01       --------gaagacaaggccaccc-----------agaccctc--ggccc
                                                                          

A0A2K5NJZ2_PMAIP1-      aactc---------------------------------------------
A0A2K5LDM6_BIK-01       gcgcctggcccagctctctgaggtggccatgcacagcctgggtctggctt
A0A2K5KZ69_HRK-01       gcgcg---ctccccacctactggccctgg---------------------
A0A2K5NU92_BCL2L11      ggccttcaaccactatctcagtgcaatggtagtcattctggaggatatag
A0A2K5NU92_BCL2L11      ggccttcaaccactatctcagtgcaatgg----at-----gag-------
A0A2K5NU92_BCL2L11      ---------------------------------cttccaggag-------
A0A2K5NU92_BCL2L11      ggccttcaaccactatctcagtgcaatgg----tt---------------
A0A2K5NU92_BCL2L11      ggccttcaaccactatctcagtgcaat-----------------------
A0A2K5NU92_BCL2L11      ggccttcaaccactatctcagtgcaatgg----cttccaggag-------
A0A2K5NU92_BCL2L11      ggccttcaaccactatctcagtgcaatgg----cttccaggag-------
A0A2K5NU92_BCL2L11      ggccttcaaccactatctcagtgcaatgg----cttccaggag-------
A0A2K5NU92_BCL2L11      ggccttcaaccactatctcagtgcaatgg----cttccaggag-------
A0A2K5NU92_BCL2L11      ggccttcaaccactatctcagtgcaatgg----ctaactgg---------
A0A2K5M0C1_BAD-02       cgagt---cttccagtcctggtgggatcg--------gaactt-------
A0A2K5M0C1_BAD-03       ccaca---gctcctaccccgcggggacggaggaggacgaaggg-------
A0A2K5M0C1_BAD-01       ccaca---gctcctaccccgcggggacggaggaggacgaaggg-------
A0A2K5P2T8_BBC3-03      gggag---atcggggcccagctg-------------cggcgga-------
A0A2K5MJY6_BMF-02       agcct---cccccagccaaggtgtcatgc--tgccttgtgggg-------
A0A2K5MJY6_BMF-01       agcct---cccccagccaaggtgtcatgc--tgccttgtgggg-------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5LDM6_BIK-01       tcatctgcgaccagacggacgacatcagggatgttcttagaagtttcatg
A0A2K5KZ69_HRK-01       --------------------------------ctgtgcgcggccgcgca-
A0A2K5NU92_BCL2L11      gtgatagttcattgtggtttggatttatatttactggcttagatttgtat
A0A2K5NU92_BCL2L11      -------------gccactggatcct---------ccctcagaattgccc
A0A2K5NU92_BCL2L11      -------------gcaggctgaacctgcagatatgcgcccggagatacgg
A0A2K5NU92_BCL2L11      ----------------------------------------agagaaatag
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      -------------gcaggctgaacctgcagatatgcgcccggagatacgg
A0A2K5NU92_BCL2L11      -------------gcaggctgaacctgcagatatgcgcccggagatacgg
A0A2K5NU92_BCL2L11      -------------gcaggctgaacctgcagatatgcgcccggagatacgg
A0A2K5NU92_BCL2L11      -------------gcaggctgaacctgcagatatgcgcccggagatacgg
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5M0C1_BAD-02       -----------gggcaggggaagctccgc--cccctcc-cagtgacctt-
A0A2K5M0C1_BAD-03       -----------atggaggaggagcccagc--ccctttcggggccgctcg-
A0A2K5M0C1_BAD-01       -----------atggaggaggagcccagc--ccctttcggggccgctcg-
A0A2K5P2T8_BBC3-03      -----------tggcggacg-acctcaacg--------------------
A0A2K5MJY6_BMF-02       -----------taactgaggaaccccagcgactcttttacggcaatgctg
A0A2K5MJY6_BMF-01       -----------taactgaggaaccccagcgactcttttacg---------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5LDM6_BIK-01       gat-----------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5MJY6_BMF-02       gctaccggcttcctctccctgccagtttcccggcagtcttgcccatcggg
A0A2K5MJY6_BMF-01       --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5LDM6_BIK-01       ----ggtttcaccacccttagggagaacataatgaggt------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5M0C1_BAD-02       ----cgctccacgccccgaaactccacccgctctcactgtcctggtcggc
A0A2K5M0C1_BAD-03       ----cgctccgcgccccccaacctc-------------------------
A0A2K5M0C1_BAD-01       ----cgctccgcgccccccaacctc-------------------------
A0A2K5P2T8_BBC3-03      ----cgcagtacgagcggcggagacaa-----------------------
A0A2K5MJY6_BMF-02       gagcagccccccgaagggcagtggcaacatcgagcagaggtacagattgc
A0A2K5MJY6_BMF-01       --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5M0C1_BAD-02       catcttgga-----------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5MJY6_BMF-02       ccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagc
A0A2K5MJY6_BMF-01       --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      ----------------------ttctgctcaggaacctga----------
A0A2K5LDM6_BIK-01       --tctggagatccccgaatcc-caggtcctgggtgtcccatgaacaggtg
A0A2K5KZ69_HRK-01       ------ggtggcggcgct----ggcggcctggctgctcagcaggcg----
A0A2K5NU92_BCL2L11      ----------------------ggccacca--------------ccacag
A0A2K5NU92_BCL2L11      ----------------------ttcatagggaagt---------tcagtg
A0A2K5NU92_BCL2L11      ----------------------atcgcccaagagttgcggcgaatcggag
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      ----------------------atcgcccaagagttgcggcgaatcggag
A0A2K5NU92_BCL2L11      ----------------------atcgcccaagagttgcggcgaatcggag
A0A2K5NU92_BCL2L11      ----------------------atcgcccaagagttgcggcgaatcggag
A0A2K5NU92_BCL2L11      ----------------------atcgcccaagagttgcggcgaatcggag
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5M0C1_BAD-02       --tatgggcggaagtgcttccctcaggccttatgcaaaagaggatccgtg
A0A2K5M0C1_BAD-03       ----tgggcagcacagcgt---tatggccgcgagctccggaggatga---
A0A2K5M0C1_BAD-01       ----tgggcagcacagcgt---tatggccgcgagctccggaggatgagtg
A0A2K5P2T8_BBC3-03      --gaggagcagcagcga-----caccgcccctcgccctggagggtcctgt
A0A2K5MJY6_BMF-02       aacaccagcagaaccga-----aatcgcgtgtgg---tggcagatcct--
A0A2K5MJY6_BMF-01       --caccagcagaaccga-----aatcgcgtgtgg---tggcagatcct--
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5LDM6_BIK-01       ctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacct
A0A2K5KZ69_HRK-01       --gaacttgtag--------------------------------------
A0A2K5NU92_BCL2L11      tcaagatacaga-------------acaactcaaccacaaggatttc---
A0A2K5NU92_BCL2L11      gccgctcgaatg-------------cttagcatca---------------
A0A2K5NU92_BCL2L11      acgagtttaacg-------------cttactatgcaaggaggttg-----
A0A2K5NU92_BCL2L11      ------------------------------------aggaagttgtc---
A0A2K5NU92_BCL2L11      ----------------------------------------gggtattttt
A0A2K5NU92_BCL2L11      acgagtttaacg-------------cttactatgcaaggagggtattttt
A0A2K5NU92_BCL2L11      acgagtttaacg-------------cttactatgcaaggagggtattttt
A0A2K5NU92_BCL2L11      acgagtttaacg-------------cttactatgcaaggaggatgtcgct
A0A2K5NU92_BCL2L11      acgagtttaacg-------------cttactatgcaaggaggttagag--
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5M0C1_BAD-02       ctgcctctttcg--------------------------------gtggga
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-01       acgagtttgtggactcctttaagggacttcctcgcccgaagagcgcgggc
A0A2K5P2T8_BBC3-03      acaatctcatca-----tgggactcctgcccttacccaggggccacagag
A0A2K5MJY6_BMF-02       ----cctcttcc-----tgcacaaccttgctttgaatggagaagagaaca
A0A2K5MJY6_BMF-01       ----cctcttcc-----tgcacaaccttgctttgaatggagaagagaaca
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5LDM6_BIK-01       gctgctcaagtga-------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5NU92_BCL2L11      -------tcatga-------------------------------------
A0A2K5NU92_BCL2L11      -------agctaa-------------------------------------
A0A2K5NU92_BCL2L11      -------gcagaa-------------------------------------
A0A2K5NU92_BCL2L11      -------gtgtag-------------------------------------
A0A2K5NU92_BCL2L11      -------gaataa-------------------------------------
A0A2K5NU92_BCL2L11      -------gaataattaccaagcagccgaagaccacccacaaatggttatc
A0A2K5NU92_BCL2L11      -------gaataattaccaagcagccgaagaccacccacaaatggttatc
A0A2K5NU92_BCL2L11      tccacctgattaa-------------------------------------
A0A2K5NU92_BCL2L11      -------aaatag-------------------------------------
A0A2K5NU92_BCL2L11      -------gactag-------------------------------------
A0A2K5M0C1_BAD-02       gggctgacccagattc----------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-01       acagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtc
A0A2K5P2T8_BBC3-03      cccccgaaatggagcc----------------------------------
A0A2K5MJY6_BMF-02       ggaacggggcgggccc----------------------------------
A0A2K5MJY6_BMF-01       ggaacggggcgggccc----------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      -------------------------------------------------
A0A2K5LDM6_BIK-01       -------------------------------------------------
A0A2K5KZ69_HRK-01       -------------------------------------------------
A0A2K5NU92_BCL2L11      -------------------------------------------------
A0A2K5NU92_BCL2L11      -------------------------------------------------
A0A2K5NU92_BCL2L11      ----------ctcctggcatcctccacctga------------------
A0A2K5NU92_BCL2L11      -------------------------------------------------
A0A2K5NU92_BCL2L11      -------------------------------------------------
A0A2K5NU92_BCL2L11      ttacgactgttgcgttacattgtccgcctggtgtggagaatgcattga-
A0A2K5NU92_BCL2L11      ttacgactgttgcgttacattgtccgcctggtgtggagaatgcattga-
A0A2K5NU92_BCL2L11      -------------------------------------------------
A0A2K5NU92_BCL2L11      -------------------------------------------------
A0A2K5NU92_BCL2L11      -------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------ccttccggtgcatgtga
A0A2K5M0C1_BAD-03       -------------------------------------------------
A0A2K5M0C1_BAD-01       ctggtgggatcggaacttgggcaggggaagctccgccccctcccagtga
A0A2K5P2T8_BBC3-03      ------------------------------------------caattag
A0A2K5MJY6_BMF-02       ------------------------------------------taggtga
A0A2K5MJY6_BMF-01       ------------------------------------------tag----
                                                                         

© 1998-2018