Dataset for CDS classical BH3-containing proteins of organism Cavia porcellus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
A0A286XXB0_BMF-02       atgcccggggcgggcgtattttggaaacaataccgcgcgcgccgccgccg
A0A286XXB0_BMF-03       --------------------------------------------------
A0A286XXB0_BMF-01       --------------------------------------------------

A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
A0A286XXB0_BMF-02       ccgcggacccgaccccccccgagtgttcgtcacgctggaccctggcacag
A0A286XXB0_BMF-03       --------------------------------------------------
A0A286XXB0_BMF-01       --------------------------------------------------

A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
H0V608_BAD-01           -----------------------------------------------atg
H0W025_BIK-01           --------------atgtcggaagcaaaacctgtcgccagggacccactg
A0A286XXB0_BMF-02       agccctggcaccacgactcggaggccgattctctctcctggagtcaccca
A0A286XXB0_BMF-03       -----------------------------------------gttttccca
A0A286XXB0_BMF-01       --------------------------------------------------

A0A286XJN2_BCL2L11      ------------atggccaagcaaccttccga------tgtaagttgtga
A0A286XJN2_BCL2L11      ------------atggccaagcaaccttccga------tgtaagttgtga
A0A286XJN2_BCL2L11      ------------atggccaagcaaccttccga------tgtaagttgtga
A0A286XF37_PMAIP1-      ---------------------------------------atgcctggaaa
H0V608_BAD-01           ttccagatcccagagtttgagcca--------------agtgagcaggaa
H0W025_BIK-01           atggagaccccgctgtttgagccaccccctgggcctctgctggctgaagg
A0A286XXB0_BMF-02       ggggaga---------tggagccacctc----------agtgtgtggagg
A0A286XXB0_BMF-03       agggaga---------tggagccacctc----------agtgtgtggagg
A0A286XXB0_BMF-01       ------a---------tggagccacctc----------agtgtgtggagg

A0A286XJN2_BCL2L11      gtg-tgacagagaaggtggacaattgcagcctgctgagaggccatcccag
A0A286XJN2_BCL2L11      gtg-tgacagagaaggtggacaattgcagcctgctgagaggccatcccag
A0A286XJN2_BCL2L11      gtg-tgacagagaaggtggacaattgcagcctgctgagaggccatcccag
A0A286XF37_PMAIP1-      ggtgtgtaagagcgcgcagccga--actccacgcgggcag----------
H0V608_BAD-01           gac-t---------------cca--gct-c-tgaagagag----------
H0W025_BIK-01           ggc-tttggg----tgtgacgca--gccac-tgtgggcag----------
A0A286XXB0_BMF-02       agc-tggaggatgatgtgttcca--ac--c-cgaggatgg----------
A0A286XXB0_BMF-03       agc-tggaggatgatgtgttcca--ac--c-cgaggatgg----------
A0A286XXB0_BMF-01       agc-tggaggatgatgtgttcca--ac--c-cgaggatgg----------
                            *                 *   *  *  *  *   *          

A0A286XJN2_BCL2L11      ctcagggctggggccccaacctccctacagacggagcccca---------
A0A286XJN2_BCL2L11      ctcagggctggggccccaacctccctacagacggagccccaaggtaatcc
A0A286XJN2_BCL2L11      ctcagggctggggccccaacctccctacagacggagccccaaggtaatcc
A0A286XF37_PMAIP1-      ----agctagaagtt-----------gagtgtgctgccc-----------
H0V608_BAD-01           ----gggcctgggccccagccccacaggggac---gagctaggc------
H0W025_BIK-01           ----a-----ggacctcagtccccctggggacactaacctcatg------
A0A286XXB0_BMF-02       ----g-----gagcc-----------ggggaccc----------------
A0A286XXB0_BMF-03       ----g-----gagcc-----------ggggaccc----------------
A0A286XXB0_BMF-01       ----g-----gagcc-----------ggggaccc----------------

A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      tgaaggcgcaggggaccgctccccccacggca------gccctcagggcc
A0A286XJN2_BCL2L11      tgaaggcgcaggggaccgctccccccacggca------gccctcagggcc
A0A286XF37_PMAIP1-      ----agctcaggagag------ttggag----------acacactgaatt
H0V608_BAD-01           -agcagcccagcaggaggcttcctgggggacaccagtcaccagcagaggc
H0W025_BIK-01           -gaatgcgtggaaggcagcagcctggtg----------gcc--ctg---c
A0A286XXB0_BMF-02       ----agcctgggagcctgctctctgctgatctct--ttgcc--cagagcc
A0A286XXB0_BMF-03       ----agcctgggagcctgctctctgctgatctct--ttgcc--cagagcc
A0A286XXB0_BMF-01       ----agcctgggagcctgctctctgctgatctct--ttgcc--cagagcc

A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      cgctggccccaccggccagtcctggcccttttgctaccagatccccgcta
A0A286XJN2_BCL2L11      cgctggccccaccggccagtcctggcccttttgctaccagatccccgcta
A0A286XF37_PMAIP1-      ccctgg--------------------------------------------
H0V608_BAD-01           agctga--------------------------------------------
H0W025_BIK-01           ggctgg--------------------------------------------
A0A286XXB0_BMF-02       agctgg--------------------------------------------
A0A286XXB0_BMF-03       agctgg--------------------------------------------
A0A286XXB0_BMF-01       agctgg--------------------------------------------

A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      ttcatctttgtgagaagatcttccctgctgtctcgatcctccagtgggta
A0A286XJN2_BCL2L11      ttcatctttgtgagaagatcttccctgctgtctcgatcctccagtgggta
A0A286XF37_PMAIP1-      -----------------------gttgcaccacggagg-ccttggaggtg
H0V608_BAD-01           -----------------------gaagcagcaggagccaccatggaggca
H0W025_BIK-01           -----------------------cctgcatcggtgacg-----agatgga
A0A286XXB0_BMF-02       -----------------------actgtccccttggtc-----ggctgca
A0A286XXB0_BMF-03       -----------------------actgtccccttggtc-----ggctgca
A0A286XXB0_BMF-01       -----------------------actgtccccttggtc-----ggctgca

A0A286XJN2_BCL2L11      ---------------agac----aggagcccggcac-----ccatgagtt
A0A286XJN2_BCL2L11      tttctcttttgacacagac----aggagcccggcac-----ccatgagtt
A0A286XJN2_BCL2L11      tttctcttttgacacagac----aggagcccggcac-----ccatgagtt
A0A286XF37_PMAIP1-      ctt--------gcagagat-------------ggct--------------
H0V608_BAD-01           ct---------gtggctat----ggagacccggagt---cgccaccggtc
H0W025_BIK-01           cct--------gcgcctac----ggagcccccgcct--ggcccagctgcc
A0A286XXB0_BMF-02       cctctttcctctcacccactgctgtggccctgggcttcgccccaccagcc
A0A286XXB0_BMF-03       cctctttcctctcacccactgctgtggccctgggcttcgccccaccagcc
A0A286XXB0_BMF-01       cctctttcctctcacccactgctgtggccctgggcttcgccccaccagcc
                                         *              *                 

A0A286XJN2_BCL2L11      -----------------------gtgacaaatcaacacaaaccccaagtc
A0A286XJN2_BCL2L11      -----------------------gtgacaaatcaacacaaaccccaagtc
A0A286XJN2_BCL2L11      -----------------------gtgacaaatcaacacaaaccccaagtc
A0A286XF37_PMAIP1-      --------------------gggaagaaggcgcgg---aagagctcgg--
H0V608_BAD-01           ttatcctgcagggactgaggaggaggaagggatggaggaggagctcagtc
H0W025_BIK-01           --------------------agggag----ggcagtgcacagcct--ggc
A0A286XXB0_BMF-02       --------------------aggaagacaaggccactcagaccctcagcc
A0A286XXB0_BMF-03       --------------------aggaagacaaggccactcagaccctcagcc
A0A286XXB0_BMF-01       --------------------aggaagacaaggccactcagaccctcagcc
                                                 *            *    *   *  

A0A286XJN2_BCL2L11      c------tccttgccaggccttcaaccattatctcagtgcaatggcttcc
A0A286XJN2_BCL2L11      c------tccttgccaggccttcaaccattatctcagtgcaatggcttcc
A0A286XJN2_BCL2L11      c------tccttgccaggccttcaaccattatctcagtgcaatggcttcc
A0A286XF37_PMAIP1-      -----------agccgg------a--------tccggcac--gggcgcgc
H0V608_BAD-01           catt---------ccggg---------------gccgctc------gcgc
H0W025_BIK-01           catcacttac-agccag------a--------tggggctctggggtgtgc
A0A286XXB0_BMF-02       catcctctccaagccagggtgtca--------tgctgccttgtggggtga
A0A286XXB0_BMF-03       catcctctccaagccagggtgtca--------tgctgccttgtggggtga
A0A286XXB0_BMF-01       catcctctccaagccagggtgtca--------tgctgccttgtggggtga
                                     ** *                   *             

A0A286XJN2_BCL2L11      atgaggcagtct-----------------caggctggacctccgcatt--
A0A286XJN2_BCL2L11      atgaggcagtct-----------------caggctggacctccgcatt--
A0A286XJN2_BCL2L11      atgaggcagtct-----------------caggctggacctccgcatt--
A0A286XF37_PMAIP1-      gcgg---------------------------agctggaagtcgagtgt--
H0V608_BAD-01           tcgg------------------------------cgccacccaacctc--
H0W025_BIK-01           tcgg-------------------------aaggctgaccctcagtctc--
A0A286XXB0_BMF-02       ctgaggaaccccagcgactcttttatggcaatgctggctaccggcttcct
A0A286XXB0_BMF-03       ctgaggaaccccagcgactcttttatggcaatgctggctaccggcttcct
A0A286XXB0_BMF-01       ctgaggaaccccagcgactcttttatggcaatgctggctaccggcttcct
                          *                                *     *        

A0A286XJN2_BCL2L11      ---tgcgcccag----------------------agatatggatcgcaca
A0A286XJN2_BCL2L11      ---tgcgcccag----------------------agatatggatcgcaca
A0A286XJN2_BCL2L11      ---tgcgcccag----------------------agatatggatcgcaca
A0A286XF37_PMAIP1-      ---gctgctcag-------------------ttgagaaga------attg
H0V608_BAD-01           tgggctgcacag---cgctacggccgagagctccggaggatgagcgac--
H0W025_BIK-01           ------gc-cag------------------cctcag-gga----caatgt
A0A286XXB0_BMF-02       ctccctgc-cagtttccctgcaggcttgccccttgg-ggagcagccccct
A0A286XXB0_BMF-03       ctccctgc-cagtttccctgcaggcttgccccttgg-ggagcagccccct
A0A286XXB0_BMF-01       ctccctgc-cagtttccctgcaggcttgccccttgg-ggagcagccccct
                              ** ***                       *              

A0A286XJN2_BCL2L11      ggaattgcgtcg-------catcggagatga--------------gttta
A0A286XJN2_BCL2L11      ggaattgcgtcg-------catcggagatga--------------gttta
A0A286XJN2_BCL2L11      ggaattgcgtcg-------catcggagatga--------------gttta
A0A286XF37_PMAIP1-      gagataaactga--atttccagcagaaa-----------------cttat
H0V608_BAD-01           --gagttcgtgg--ac-tccttcaagggt----------------cttcc
H0W025_BIK-01           gtgggcctgtgg--acgcccagc----------------------ctccc
A0A286XXB0_BMF-02       gaaggtcagtggcaacatcgagcagaggtacagatcgcccggaagcttca
A0A286XXB0_BMF-03       gaaggtcagtggcaacatcgagcagaggtacagatcgcccggaagcttca
A0A286XXB0_BMF-01       gaaggtcagtggcaacatcgagcagaggtacagatcgcccggaagcttca
                                 *            *                       *   

A0A286XJN2_BCL2L11      atgcctcgtacccaaggcg------------------ggtgttcttgaat
A0A286XJN2_BCL2L11      atgcctcgtacccaaggcg------------------ggtgttcttgaat
A0A286XJN2_BCL2L11      atgcctcgtacccaaggcg------------------ggtgttcttgaat
A0A286XF37_PMAIP1-      gtatttgatttccaaactc-------------------------------
H0V608_BAD-01           tcgcccgaagagcgcgggcacagcgac----------gaagctgtggcag
H0W025_BIK-01           gtgcctgg-----gtgtcc-ccccg-------------------------
A0A286XXB0_BMF-02       gtgcattgcagaccagttc-caccgacttcacattcaacaacaccaacag
A0A286XXB0_BMF-03       gtgcattgcagaccagttc-caccgacttcacattcaacaacaccaacag
A0A286XXB0_BMF-01       gtgcattgcagaccagttc-caccgacttcacattcaacaacaccaacag

A0A286XJN2_BCL2L11      cattaccagcccgctgaagaccaaccccaaatggttatcttgcgattgtt
A0A286XJN2_BCL2L11      cattaccagcccgctgaagaccaaccccaaatggttatcttgcgattgtt
A0A286XJN2_BCL2L11      cattaccagcccgctgaagaccaaccccaaatggttatcttgcgattgtt
A0A286XF37_PMAIP1-      -------------------atcagtttg----------------------
H0V608_BAD-01           aactctaattggacacgg-gccatccagtcctggtgggatcggaacttgg
H0W025_BIK-01           --ctggacctgcaggtggctgctgcctgtgctgctgttgctgctgctgct
A0A286XXB0_BMF-02       aaccggaatcgcgcatggtggcag---gtcttactcttcatgc-------
A0A286XXB0_BMF-03       aaccggaatcgcgcatggtggcag---gtcttactcttcatgc-------
A0A286XXB0_BMF-01       aaccggaatcgcgcatggtggcag---gtcttactcttcatgc-------

A0A286XJN2_BCL2L11      acgttacattatccgcctggtatggcgaatgcat----------------
A0A286XJN2_BCL2L11      acgttacattatccgcctggtatggcgaatgcat----------------
A0A286XJN2_BCL2L11      acgttacattatccgcctggtatggcgaatgcat----------------
A0A286XF37_PMAIP1-      -----gtaacc---------------------------------------
H0V608_BAD-01           ggagaggaggctccgccc---------------cctcccaggagtcggtc
H0W025_BIK-01           gctggggaccctgcgcct-------------------------gctgctg
A0A286XXB0_BMF-02       -----acaacctgggtctgaacggagaagagaacagggaaggggcaggtc
A0A286XXB0_BMF-03       -----acaacctgggtctgaacggagaagagaacagggaaggggcaggtc
A0A286XXB0_BMF-01       -----acaacctgggtctgaacggagaagagaacagggaaggggcaggtc

A0A286XJN2_BCL2L11      -----tga
A0A286XJN2_BCL2L11      -----tga
A0A286XJN2_BCL2L11      -----tga
A0A286XF37_PMAIP1-      -----tga
H0V608_BAD-01           -----tga
H0W025_BIK-01           c--agtga
A0A286XXB0_BMF-02       ccaggtga
A0A286XXB0_BMF-03       ccaggtga
A0A286XXB0_BMF-01       ccaggtga

© 1998-2019