Dataset for CDS BMF of organism Cavia porcellus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A286XXB0_BMF-02      atgcccggggcgggcgtattttggaaacaataccgcgcgcgccgccgccg
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
                                                                         

A0A286XXB0_BMF-02      ccgcggacccgaccccccccgagtgttcgtcacgctggaccctggcacag
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
                                                                         

A0A286XXB0_BMF-02      agccctggcaccacgactcggaggccgattctctctcctggagtcaccca
A0A286XXB0_BMF-03      -----------------------------------------gttttccca
A0A286XXB0_BMF-01      --------------------------------------------------
                                                                         

A0A286XXB0_BMF-02      ggggagatggagccacctcagtgtgtggaggagctggaggatgatgtgtt
A0A286XXB0_BMF-03      agggagatggagccacctcagtgtgtggaggagctggaggatgatgtgtt
A0A286XXB0_BMF-01      ------atggagccacctcagtgtgtggaggagctggaggatgatgtgtt
                             ********************************************

A0A286XXB0_BMF-02      ccaacccgaggatggggagccggggacccagcctgggagcctgctctctg
A0A286XXB0_BMF-03      ccaacccgaggatggggagccggggacccagcctgggagcctgctctctg
A0A286XXB0_BMF-01      ccaacccgaggatggggagccggggacccagcctgggagcctgctctctg
                       **************************************************

A0A286XXB0_BMF-02      ctgatctctttgcccagagccagctggactgtccccttggtcggctgcac
A0A286XXB0_BMF-03      ctgatctctttgcccagagccagctggactgtccccttggtcggctgcac
A0A286XXB0_BMF-01      ctgatctctttgcccagagccagctggactgtccccttggtcggctgcac
                       **************************************************

A0A286XXB0_BMF-02      ctctttcctctcacccactgctgtggccctgggcttcgccccaccagcca
A0A286XXB0_BMF-03      ctctttcctctcacccactgctgtggccctgggcttcgccccaccagcca
A0A286XXB0_BMF-01      ctctttcctctcacccactgctgtggccctgggcttcgccccaccagcca
                       **************************************************

A0A286XXB0_BMF-02      ggaagacaaggccactcagaccctcagcccatcctctccaagccagggtg
A0A286XXB0_BMF-03      ggaagacaaggccactcagaccctcagcccatcctctccaagccagggtg
A0A286XXB0_BMF-01      ggaagacaaggccactcagaccctcagcccatcctctccaagccagggtg
                       **************************************************

A0A286XXB0_BMF-02      tcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggc
A0A286XXB0_BMF-03      tcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggc
A0A286XXB0_BMF-01      tcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggc
                       **************************************************

A0A286XXB0_BMF-02      aatgctggctaccggcttcctctccctgccagtttccctgcaggcttgcc
A0A286XXB0_BMF-03      aatgctggctaccggcttcctctccctgccagtttccctgcaggcttgcc
A0A286XXB0_BMF-01      aatgctggctaccggcttcctctccctgccagtttccctgcaggcttgcc
                       **************************************************

A0A286XXB0_BMF-02      ccttggggagcagccccctgaaggtcagtggcaacatcgagcagaggtac
A0A286XXB0_BMF-03      ccttggggagcagccccctgaaggtcagtggcaacatcgagcagaggtac
A0A286XXB0_BMF-01      ccttggggagcagccccctgaaggtcagtggcaacatcgagcagaggtac
                       **************************************************

A0A286XXB0_BMF-02      agatcgcccggaagcttcagtgcattgcagaccagttccaccgacttcac
A0A286XXB0_BMF-03      agatcgcccggaagcttcagtgcattgcagaccagttccaccgacttcac
A0A286XXB0_BMF-01      agatcgcccggaagcttcagtgcattgcagaccagttccaccgacttcac
                       **************************************************

A0A286XXB0_BMF-02      attcaacaacaccaacagaaccggaatcgcgcatggtggcaggtcttact
A0A286XXB0_BMF-03      attcaacaacaccaacagaaccggaatcgcgcatggtggcaggtcttact
A0A286XXB0_BMF-01      attcaacaacaccaacagaaccggaatcgcgcatggtggcaggtcttact
                       **************************************************

A0A286XXB0_BMF-02      cttcatgcacaacctgggtctgaacggagaagagaacagggaaggggcag
A0A286XXB0_BMF-03      cttcatgcacaacctgggtctgaacggagaagagaacagggaaggggcag
A0A286XXB0_BMF-01      cttcatgcacaacctgggtctgaacggagaagagaacagggaaggggcag
                       **************************************************

A0A286XXB0_BMF-02      gtcccaggtga
A0A286XXB0_BMF-03      gtcccaggtga
A0A286XXB0_BMF-01      gtcccaggtga
                       ***********

© 1998-2018