Dataset for CDS classical BH3-containing proteins of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F1PUF4_BIK-01          -----------------------------atg------------------
J9NWV6_BCL2L11-01      -----------------------------atggcaaagcaaccttcagat
J9PB65_BMF-01          -----------------------------atggagccgcctcagtgtgtg
Q1PCT2_PMAIP1-01       -----------------------------atg------------------
F1PK10_BAD-01          accccagagaatccctcatctgctcccgcgcaggacccaggcacaaggaa
Q45KI9_BAD-01          --------------------------------------------------
E2RLD4_HRK-01          -----------------------------atg------------------
J9NTK9_BBC3-01         -----------------------------atggcccgagcacgccaggag
                                                                         

F1PUF4_BIK-01          --------------tctcactcaggacccctctccaggaacctctttctg
J9NWV6_BCL2L11-01      gtaagtt--ctgagtgtgacagagaaggtggacaattgcagcctgctgag
J9PB65_BMF-01          gagg-----------------------------------agctggaggat
Q1PCT2_PMAIP1-01       --------------------------------------------------
F1PK10_BAD-01          gtcaggaaccgagcggcgggagaagagctgtgccctaactacctgctgtc
Q45KI9_BAD-01          --------------------------------------------------
E2RLD4_HRK-01          ---------------------------------------tgcccgtgccc
J9NTK9_BBC3-01         ggcagctccccggagcccgtagagggcctggcccgcgacggtccgcgccc
                                                                         

F1PUF4_BIK-01          agcaccttcctgcaggagc----------atggcccagaagttctggagg
J9NWV6_BCL2L11-01      aggcctcctcagctcaggcct--------ggggcccctacctctctacag
J9PB65_BMF-01          gatgtgttccagccagaggatggggagccggggacccagcctg-------
Q1PCT2_PMAIP1-01       -------cccggccggaag----------gcgcgcaaga-----------
F1PK10_BAD-01          ttgcccccacagcccagag---------catgttccagatccc-------
Q45KI9_BAD-01          -----------------------------atgttccagatccc-------
E2RLD4_HRK-01          cctgcaccgcggccgc-------------gggcccccggccgt-------
J9NTK9_BBC3-01         gtttcccctcagccgcctg----------gtgccctcggccgt-------
                                                      *  *               

F1PUF4_BIK-01          ttccgggcatgaca-gatctcgtggagtattatgaccctgggccctcccc
J9NWV6_BCL2L11-01      acagaacagcaaggtaatcctgaaggcgaaggggaccgctgcccccaagg
J9PB65_BMF-01          --------ggagcttgctctctgctgacctg-------------tttgcc
Q1PCT2_PMAIP1-01       --------------------------------------------------
F1PK10_BAD-01          --------agagtttgagcccagtgagcaggaagactccagccctgcaaa
Q45KI9_BAD-01          --------agagtttgagcccagtgagcaggaagactccagccctgcaaa
E2RLD4_HRK-01          --------gt----------------------------------------
J9NTK9_BBC3-01         --------gtcctgcggcctctgcgag----------cccggcctgcccg
                                                                         

F1PUF4_BIK-01          taacagcaacaaccccgacgatgtggccatgcggctggccttcatcgggg
J9NWV6_BCL2L11-01      cagccctcagggcccgctggccccaccagccagccccggcccttttgcta
J9PB65_BMF-01          cagagccagctggactgccccctcagccgtctgcatctcttccctctcac
Q1PCT2_PMAIP1-01       -------------------------gcgcgcagcccggccccacg-----
F1PK10_BAD-01          taggggcttgggccccagccccacaggggaccg---gcccccaagccctg
Q45KI9_BAD-01          taggggcttgggccccagccccacaggggaccg---gcccccaagccctg
E2RLD4_HRK-01          --gcgcctgcagc------------gcgggccgcctggctctgcgctcgt
J9NTK9_BBC3-01         ccgcccctgctgcccctgccctgctgcccgctgcctacctctgcgccc--
                                                       *                 

F1PUF4_BIK-01          acgagatggaa----------gtgagatggatgcttccccgcgttggcga
J9NWV6_BCL2L11-01      ccagatccccgcttttcatctttgtgagaagatcctccctgctgtctcga
J9PB65_BMF-01          ccactg---------------ctg--------tggccct--gggcttcga
Q1PCT2_PMAIP1-01       ---------------------cgg--------gcccccgaagag------
F1PK10_BAD-01          gcaagcaccagcagacggccccag--------gcctcctaggggaagctg
Q45KI9_BAD-01          gcaagcaccagcagacggccccag--------gcctcctaggggaagctg
E2RLD4_HRK-01          ccgccgcgcagc------tcacgg--------ccgctc------------
J9NTK9_BBC3-01         ccaccgccccgcccgccgtcaccg--------ccgccctggggggccc--
                                              *             *            

F1PUF4_BIK-01          gctgcccgggatggccatgtacagcttggcttttacctacaaccagacag
J9NWV6_BCL2L11-01      tcctccag-------tgggtatttctcttttgacacagacaggagcccgg
J9PB65_BMF-01          cccaccag-------ccaggaagacaaggccacccagaccctcagtccgg
Q1PCT2_PMAIP1-01       ------------------------------------------------ct
F1PK10_BAD-01          gtcaccag-------caggggcagccagccagccgcaaacaccatggagg
Q45KI9_BAD-01          gtcaccag-------caggggcagccagccagccgcaaacaccatggagg
E2RLD4_HRK-01          --------------------ggctcaaggcgctc--------------gg
J9NTK9_BBC3-01         -ccgctgg-------cctgggggtccccgcagcc--------------gg
                                                                         

F1PUF4_BIK-01          g-cctgagaggtgttcttagaagtttcctggatggtcttgctaacctcag
J9NWV6_BCL2L11-01      cacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccag
J9PB65_BMF-01          c-ctc----cccaagtcagggtgtcatgctgccttgtggggtgaccgaag
Q1PCT2_PMAIP1-01       c-gaagtggagtgtgcca--------ttcagctcaggaaatt--------
F1PK10_BAD-01          c-gctggggctgagacccggagtcgccacagctc-----gttccccgcgg
Q45KI9_BAD-01          c-gctggggctgagacccggagtcgccacagctc-----gttccccgcgg
E2RLD4_HRK-01          c-gacgag--ctgcac------------cagcgcaccatgt----ggcgg
J9NTK9_BBC3-01         c-cccgaggcccgcgccccgacggtcctcagccctcactgtcgccggcgg
                                                                         

F1PUF4_BIK-01          g---------------------gagaacatccgcatctggagctt-----
J9NWV6_BCL2L11-01      gccttcaac-------------------------------cattatctca
J9PB65_BMF-01          agccccagc--gactcttttatggcaacgctggctaccggctccctctcc
Q1PCT2_PMAIP1-01       ---------------------tggagacaaa-------------------
F1PK10_BAD-01          ggaccgacgaggatgaaggaatggaggaagaagagctcagcccttt----
Q45KI9_BAD-01          ggaccgacgaggatgaaggaatggaggaagaagagctcagcccttt----
E2RLD4_HRK-01          cgccgcgcg------------cggagccggagggcgccggcgc--c----
J9NTK9_BBC3-01         aacagcacc------------tggaatcgccggtgcccagcgc--c----
                                                                         

F1PUF4_BIK-01          ---cctgaccttccggaacagggtgtccccc-------------------
J9NWV6_BCL2L11-01      gtgcaatggcttccatgaggcagtctc------aggctgtacctgcagat
J9PB65_BMF-01          ctgccagtttccctgcaggcttgcctctcctcgagcagcccccggaaggg
Q1PCT2_PMAIP1-01       --------------------------------------------------
F1PK10_BAD-01          ---ccgggggcgctcgagctcagcgcccccc--aacctctgc--------
Q45KI9_BAD-01          ---ccgggggcgctcgagctcagcgcccccc--aacctctgc--------
E2RLD4_HRK-01          ---ccgcgcgctc-----------cccacct--a----------------
J9NTK9_BBC3-01         ---ccgggggccctggcgggcggtcccaccc--aagcagccccgggagtc
                                                                         

F1PUF4_BIK-01          ---------------------aacccggggcgcgggctggtgctgtcgct
J9NWV6_BCL2L11-01      atgcgcccggagatatggattgcacaag------------agttgcggcg
J9PB65_BMF-01          cagtggcaacatcgagcagaggtacagattgcccg---aaagcttcagtg
Q1PCT2_PMAIP1-01       ------------------------ctgaatttccggcagaaacttctgaa
F1PK10_BAD-01          ------------------gcggcacggcgctacggccgcgagctccgcag
Q45KI9_BAD-01          ------------------gcggcacggcgctacggccgcgagctccgcag
E2RLD4_HRK-01          ------------------ctggccctgg----ctgtgcgcggccgc-gca
J9NTK9_BBC3-01         cggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcg
                                               *                         

F1PUF4_BIK-01          gctgc-----------------------------------tgct------
J9NWV6_BCL2L11-01      tattggagacgaatttaatgcatat---------------tacccaagga
J9PB65_BMF-01          cattgcagaccagttccatc--------------------ggcttcacat
Q1PCT2_PMAIP1-01       tctgttatccaaactcttc---------------------cgctc-----
F1PK10_BAD-01          gatgagcgacgagttccagggctccttcaagggacttcctcgcccgaaga
Q45KI9_BAD-01          gatgagcgacgagttccagggctccttcaagggacttcctcgcccgaaga
E2RLD4_HRK-01          ggtggcg------------g--------------------cgctg-----
J9NTK9_BBC3-01         gatggcggacgacctcaacg--------------------cgctgtacga
                         *                                       *       

F1PUF4_BIK-01          --------------------------------------------------
J9NWV6_BCL2L11-01      gggtctttttgaataattaccaagcagccgaagccc--------------
J9PB65_BMF-01          gcagcaacaccagcaaaaccaaaatcgagtgtggtggcagattctcctct
Q1PCT2_PMAIP1-01       --------------------------------------------------
F1PK10_BAD-01          gcg--cggggacagcgacgcagatgcgacaaagcccc-------agctgg
Q45KI9_BAD-01          gcg--cggggacagcgacgcagatgcgacaaagcccc-------agctgg
E2RLD4_HRK-01          --------------------------------------------------
J9NTK9_BBC3-01         gcggcggagacaagaggagcagcagcgacaccgcccctcaccctggaggg
                                                                         

F1PUF4_BIK-01          ---------------------------------------gctggtgctgc
J9NWV6_BCL2L11-01      ---------acccccaaatgattatcttacgactgttacgttacatcgtc
J9PB65_BMF-01          tcctgcacaacctggctttg-------------------aatgcagatga
Q1PCT2_PMAIP1-01       --------------------------------------------------
F1PK10_BAD-01          acgcgcgtcatccagtcctg-------------------gtgggatcgga
Q45KI9_BAD-01          acgcgcgtcatccagtcctg-------------------gtgggatcgga
E2RLD4_HRK-01          ---------------------------------------gcggcctggct
J9NTK9_BBC3-01         tcctgtacaatctcatcatgggactcctgcccttacccaggggccgtgga
                                                                         

F1PUF4_BIK-01          tactaggctgggg------------cctccgcctcctccagtga------
J9NWV6_BCL2L11-01      cgcctggtgtgga--------------------gattgcagtga------
J9PB65_BMF-01          gaacaggaatggggcaggtcccagcttccagctagtcccgggaatatcgt
Q1PCT2_PMAIP1-01       ----------agg---------aa------------cctga---------
F1PK10_BAD-01          acttggggagagg---------aggctccgccccgtcccagtga------
Q45KI9_BAD-01          acttggggagagg---------aggctccgccccgtcccagtga------
E2RLD4_HRK-01          gctcggcaggcgg---------aa------------cttg----------
J9NTK9_BBC3-01         gccccggagatgg---------ag------------cccaattag-----
                                  *                                      

F1PUF4_BIK-01          -----------------------------------
J9NWV6_BCL2L11-01      -----------------------------------
J9PB65_BMF-01          gctctggagctcagcaggattgcagctgcctctga
Q1PCT2_PMAIP1-01       -----------------------------------
F1PK10_BAD-01          -----------------------------------
Q45KI9_BAD-01          -----------------------------------
E2RLD4_HRK-01          -----------------------------------
J9NTK9_BBC3-01         -----------------------------------
                                                          

© 1998-2018