Dataset for CDS BAD of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F1PK10_BAD-01      accccagagaatccctcatctgctcccgcgcaggacccaggcacaaggaagtcaggaacc
Q45KI9_BAD-01      ------------------------------------------------------------

F1PK10_BAD-01      gagcggcgggagaagagctgtgccctaactacctgctgtcttgcccccacagcccagagc
Q45KI9_BAD-01      ------------------------------------------------------------

F1PK10_BAD-01      atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcaaatagg
Q45KI9_BAD-01      atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcaaatagg

F1PK10_BAD-01      ggcttgggccccagccccacaggggaccggcccccaagccctggcaagcaccagcagacg
Q45KI9_BAD-01      ggcttgggccccagccccacaggggaccggcccccaagccctggcaagcaccagcagacg

F1PK10_BAD-01      gccccaggcctcctaggggaagctggtcaccagcaggggcagccagccagccgcaaacac
Q45KI9_BAD-01      gccccaggcctcctaggggaagctggtcaccagcaggggcagccagccagccgcaaacac

F1PK10_BAD-01      catggaggcgctggggctgagacccggagtcgccacagctcgttccccgcggggaccgac
Q45KI9_BAD-01      catggaggcgctggggctgagacccggagtcgccacagctcgttccccgcggggaccgac

F1PK10_BAD-01      gaggatgaaggaatggaggaagaagagctcagccctttccgggggcgctcgagctcagcg
Q45KI9_BAD-01      gaggatgaaggaatggaggaagaagagctcagccctttccgggggcgctcgagctcagcg

F1PK10_BAD-01      ccccccaacctctgcgcggcacggcgctacggccgcgagctccgcaggatgagcgacgag
Q45KI9_BAD-01      ccccccaacctctgcgcggcacggcgctacggccgcgagctccgcaggatgagcgacgag

F1PK10_BAD-01      ttccagggctccttcaagggacttcctcgcccgaagagcgcggggacagcgacgcagatg
Q45KI9_BAD-01      ttccagggctccttcaagggacttcctcgcccgaagagcgcggggacagcgacgcagatg

F1PK10_BAD-01      cgacaaagccccagctggacgcgcgtcatccagtcctggtgggatcggaacttggggaga
Q45KI9_BAD-01      cgacaaagccccagctggacgcgcgtcatccagtcctggtgggatcggaacttggggaga

F1PK10_BAD-01      ggaggctccgccccgtcccagtga
Q45KI9_BAD-01      ggaggctccgccccgtcccagtga

© 1998-2019