Dataset for CDS classical BH3-containing proteins of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

17 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F7FUT7_BIK-01           atgtctgaagtaagacccctctccagtgacatcttcatggagaccctcct
U3E722_HRK-01           atgtgc-----ccgt-----------------------------------
F6SJL0_BAD-02           atgttc-----cagatccc---------agagtttgag------------
F6SJL0_BAD-01           atgttc-----cagatccc---------agagtttgag------------
F7HPK0_BMF-01           atggag-----ccatctcagtgtgtggaggagctggaggatgatgtgttc
F7HPK0_BMF-02           atggag-----ccatctcagtgtgtggaggagctggaggatgatgtgttc
A0A2R8MW85_BBC3-03      atgaaa--------------tgtggcgtggggtctgcctgggcatgtcca
F7GW45_PMAIP1-01        atgcct-----gggaa-------------------gaaggcgc-------
F6XMC1_BCL2L11-09       atggca-----aagcaaccttccgatgtaagttctgagtgtga-------
F6XMC1_BCL2L11-06       atggca-----aagcaaccttccgatgtaagttctgagtgtga-------
F6XMC1_BCL2L11-08       atggca-----aagcaaccttccgatgtaagttctgagtgtga-------
F6XMC1_BCL2L11-04       atggca-----aagcaaccttccgatgtaagttctgagtgtga-------
F6XMC1_BCL2L11-03       atggca-----aagcaaccttccgatgtaagttctgagtgtga-------
F6XMC1_BCL2L11-05       atggca-----aagcaaccttccgatgtaagttctgagtgtga-------
F6XMC1_BCL2L11-07       atggca-----aagcaaccttccgatgtaagttctgagtgtga-------
F6XMC1_BCL2L11-01       atggca-----aagcaaccttccgatgtaagttctgagtgtga-------
F6XMC1_BCL2L11-02       atggca-----aagcaaccttccgatgtaagttctgagtgtga-------

F7FUT7_BIK-01           gtgtgagcagttcgtggatc-----ccctgaccatggaggttgttggtgg
U3E722_HRK-01           ----------------------gccccctg--caccgcggccgcgg----
F6SJL0_BAD-02           --ccgagtgagcaggaagactccagctctg--cagagaggggcctg----
F6SJL0_BAD-01           --ccgagtgagcaggaagactccagctctg--cagagaggggcctg----
F7HPK0_BMF-01           cagccagaggatggggagccagggacccaa--cccgggagctt-------
F7HPK0_BMF-02           cagccagaggatggggagccagggacccaa--cccgggagctt-------
A0A2R8MW85_BBC3-03      tgccaagtgcccagggcttc--ttcctcgg--tgtggg----t-------
F7GW45_PMAIP1-01        --gcaaga--gcgcgcaacc--gagccccg--cgcggg------------
F6XMC1_BCL2L11-09       --ccgagaaggtagacaatt--gcagcctg--cggagagacct-------
F6XMC1_BCL2L11-06       --ccgagaaggtagacaatt--gcagcctg--cggagagacct-------
F6XMC1_BCL2L11-08       --ccgagaaggtagacaatt--gcagcctg--cggagagacct-------
F6XMC1_BCL2L11-04       --ccgagaaggtagacaatt--gcagcctg--cggagagacct-------
F6XMC1_BCL2L11-03       --ccgagaaggtagacaatt--gcagcctg--cggagagacct-------
F6XMC1_BCL2L11-05       --ccgagaaggtagacaatt--gcagcctg--cggagagacct-------
F6XMC1_BCL2L11-07       --ccgagaaggtagacaatt--gcagcctg--cggagagacct-------
F6XMC1_BCL2L11-01       --ccgagaaggtagacaatt--gcagcctg--cggagagacct-------
F6XMC1_BCL2L11-02       --ccgagaaggtagacaatt--gcagcctg--cggagagacct-------
                                                   *        *             

F7FUT7_BIK-01           gagtgaccctgaagaggacctgg---------------------------
U3E722_HRK-01           ----ccccccggc-------------------------------------
F6SJL0_BAD-02           ----agccccagcaccgcagggg---------------------------
F6SJL0_BAD-01           ----agccccagcaccgcagggg---------------------------
F7HPK0_BMF-01           ------gctctctgctgacctatttgcccagagcctactggactgccccc
F7HPK0_BMF-02           ------gctctctgctgacctatttgcccagagcctactggactgccccc
A0A2R8MW85_BBC3-03      ------cccctgc-cagatgtgt---------------------------
F7GW45_PMAIP1-01        ------ctccag--cagaccttg---------------------------
F6XMC1_BCL2L11-09       ------ccccagctcagacctgg---------------------------
F6XMC1_BCL2L11-06       ------ccccagctcagacctgg---------------------------
F6XMC1_BCL2L11-08       ------ccccagctcagacctgg---------------------------
F6XMC1_BCL2L11-04       ------ccccagctcagacctgg---------------------------
F6XMC1_BCL2L11-03       ------ccccagctcagacctgg---------------------------
F6XMC1_BCL2L11-05       ------ccccagctcagacctgg---------------------------
F6XMC1_BCL2L11-07       ------ccccagctcagacctgg---------------------------
F6XMC1_BCL2L11-01       ------ccccagctcagacctgg---------------------------
F6XMC1_BCL2L11-02       ------ccccagctcagacctgg---------------------------

F7FUT7_BIK-01           ------accctgtggaggaccctttggaatgcatggagaacagtgacgca
U3E722_HRK-01           ------cgtttgcg------cctgcagcgcgggtcgcctggggctgcgc-
F6SJL0_BAD-02           --acaggcccccag------gctctggcaagcatcgacgccagg--ccc-
F6SJL0_BAD-01           --acaggcccccag------gctctggcaagcatcgacgccagg--ccc-
F7HPK0_BMF-01           tcagtcggcttcag------ctcttccctctcacccactgctgtggccc-
F7HPK0_BMF-02           tcagtcggcttcag------ctcttccctctcacccactgctgtggccc-
A0A2R8MW85_BBC3-03      ------ggtcctca------gccctcgctctcgctggcgg-agcagcac-
F7GW45_PMAIP1-01        ------aagtc------------------------gagtg-tgc--cac-
F6XMC1_BCL2L11-09       ------ggccccta------cctccc-----tacagacag-agc--cac-
F6XMC1_BCL2L11-06       ------ggccccta------cctccc-----tacagacag-agc--cac-
F6XMC1_BCL2L11-08       ------ggccccta------cctccc-----tacagacag-agc--cac-
F6XMC1_BCL2L11-04       ------ggccccta------cctccc-----tacagacag-agc--cac-
F6XMC1_BCL2L11-03       ------ggccccta------cctccc-----tacagacag-agc--cac-
F6XMC1_BCL2L11-05       ------ggccccta------cctccc-----tacagacag-agc--cac-
F6XMC1_BCL2L11-07       ------ggccccta------cctccc-----tacagacag-agc--cac-
F6XMC1_BCL2L11-01       ------ggccccta------cctccc-----tacagacag-agc--cac-
F6XMC1_BCL2L11-02       ------ggccccta------cctccc-----tacagacag-agc--cac-
                                                                  *   * * 

F7FUT7_BIK-01           ctggccctgcagctggc----------ctgcatcgcggaccagatggatg
U3E722_HRK-01           tcgtccgccgcgcagctcaccgccgcccggctcaaggcgctcggcgacga
F6SJL0_BAD-02           caggcctcccgggggacgccagtcac-cagcagggacagtcaaccagcag
F6SJL0_BAD-01           caggcctcccgggggacgccagtcac-cagcagggacagtcaaccagcag
F7HPK0_BMF-01           tggccttcgac-----c------cac-cagccaggaagacaaggctaccc
F7HPK0_BMF-02           tggccttcgac-----c------cac-cagccaggaagacaaggctaccc
A0A2R8MW85_BBC3-03      ctggagtcgcccgtgcc------cag-cgccccaggggccctggcgggcg
F7GW45_PMAIP1-01        t---------------c------aa----ctcaggaga------------
F6XMC1_BCL2L11-09       a-------------------------------------------------
F6XMC1_BCL2L11-06       aaggtaatcccgaaggc------aa----tcacggaggtgaaggggacag
F6XMC1_BCL2L11-08       aaggtaatcccgaaggc------aa----tcacggaggtgaaggggacag
F6XMC1_BCL2L11-04       aaggtaatcccgaaggc------aa----tcacggaggtgaaggggacag
F6XMC1_BCL2L11-03       aaggtaatcccgaaggc------aa----tcacggaggtgaaggggacag
F6XMC1_BCL2L11-05       aaggtaatcccgaaggc------aa----tcacggaggtgaaggggacag
F6XMC1_BCL2L11-07       aaggtaatcccgaaggc------aa----tcacggaggtgaaggggacag
F6XMC1_BCL2L11-01       aaggtaatcccgaaggc------aa----tcacggaggtgaaggggacag
F6XMC1_BCL2L11-02       a-------------------------------------------------

F7FUT7_BIK-01           tgagcctcagggc-----ccggaggctgg---------------------
U3E722_HRK-01           gctgcaccagcgcaccatgtggcggc------------------------
F6SJL0_BAD-02           cagccaccatggagagaatcccagtgtaaggatgttctcgaaagcatcag
F6SJL0_BAD-01           cagccacca-----------------------------------------
F7HPK0_BMF-01           agaccctcagcccagcctcccccagccaa---------------------
F7HPK0_BMF-02           agaccctcagcccagcctcccccagccaa---------------------
A0A2R8MW85_BBC3-03      gtcccacccaggcggcccccggagtccgc---------------------
F7GW45_PMAIP1-01        --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
F6XMC1_BCL2L11-06       ctgcctccacggcagccctcagggcccgc---------------------
F6XMC1_BCL2L11-08       ctgcctccacggcagccctcagggcccgc---------------------
F6XMC1_BCL2L11-04       ctgcctccacggcagccctcagggcccgc---------------------
F6XMC1_BCL2L11-03       ctgcctccacggcagccctcagggcccgc---------------------
F6XMC1_BCL2L11-05       ctgcctccacggcagccctcagggcccgc---------------------
F6XMC1_BCL2L11-07       ctgcctccacggcagccctcagggcccgc---------------------
F6XMC1_BCL2L11-01       ctgcctccacggcagccctcagggcccgc---------------------
F6XMC1_BCL2L11-02       --------------------------------------------------

F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
F6SJL0_BAD-02           cagggatgtccgccccagccactgactcagaagcccaacacacagagaat
F6SJL0_BAD-01           --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------

F7FUT7_BIK-01           --------------cccagctctacgaggtggccatg----tacagcccg
U3E722_HRK-01           ------------------gccgcgcgcggagccggag-------------
F6SJL0_BAD-02           gtaaagctggaggcgctggggctgtggagacccggagtcgccacagctcg
F6SJL0_BAD-01           -------tggaggcgctggggctgtggagacccggagtcgccacagctcg
F7HPK0_BMF-01           -------ggtgtcatgctgccttgtggggtgactgaggaaccccagcgac
F7HPK0_BMF-02           -------ggtgtcatgctgccttgtggggtgactgaggaaccccagcgac
A0A2R8MW85_BBC3-03      -------ggg-----gaggaggagcagtgggcccgggagatcggggccca
F7GW45_PMAIP1-01        --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
F6XMC1_BCL2L11-06       -------tggccccaccggccagccccggcccttttgctaccagatcccc
F6XMC1_BCL2L11-08       -------tggccccaccggccagccccggcccttttgctaccagatcccc
F6XMC1_BCL2L11-04       -------tggccccaccggccagccccggcccttttgctaccagatcccc
F6XMC1_BCL2L11-03       -------tggccccaccggccagccccggcccttttgctaccagatcccc
F6XMC1_BCL2L11-05       -------tggccccaccggccagccccggcccttttgctaccagatcccc
F6XMC1_BCL2L11-07       -------tggccccaccggccagccccggcccttttgctaccagatcccc
F6XMC1_BCL2L11-01       -------tggccccaccggccagccccggcccttttgctaccagatcccc
F6XMC1_BCL2L11-02       --------------------------------------------------

F7FUT7_BIK-01           ggtctcgct-----------------------------------------
U3E722_HRK-01           --------------------------------------------------
F6SJL0_BAD-02           taccccgca-----------------------------------------
F6SJL0_BAD-01           taccccgca-----------------------------------------
F7HPK0_BMF-01           tcttttacggcaatgctggctaccggcttcctctccctgccagtttcccg
F7HPK0_BMF-02           tcttttacg-----------------------------------------
A0A2R8MW85_BBC3-03      gctgcgacg-----------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
F6XMC1_BCL2L11-06       gcttttcat-----------------------------------------
F6XMC1_BCL2L11-08       gcttttcat-----------------------------------------
F6XMC1_BCL2L11-04       gcttttcat-----------------------------------------
F6XMC1_BCL2L11-03       gcttttcat-----------------------------------------
F6XMC1_BCL2L11-05       gcttttcat-----------------------------------------
F6XMC1_BCL2L11-07       gcttttcat-----------------------------------------
F6XMC1_BCL2L11-01       gcttttcat-----------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------

F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
F7HPK0_BMF-01           gcagtcttgccccttggggagcagccccccgaagggcagtggcaacatcg
F7HPK0_BMF-02           --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------

F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
F7HPK0_BMF-01           agcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttcc
F7HPK0_BMF-02           --------------------------------------------------
A0A2R8MW85_BBC3-03      -------------gatggcggacgacctcaacgcgctgtacgagc-----
F7GW45_PMAIP1-01        --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
F6XMC1_BCL2L11-06       -------------ctttgtgagaagatcctccgtgctgtctcgatcctcc
F6XMC1_BCL2L11-08       -------------ctttgtgagaagatcctccgtgctgtctcgatcctcc
F6XMC1_BCL2L11-04       -------------ctttgtgagaagatcctccgtgctgtctcgatcctcc
F6XMC1_BCL2L11-03       -------------ctttgtgagaagatcctccgtgctgtctcgatcctcc
F6XMC1_BCL2L11-05       -------------ctttgtgagaagatcctccgtgctgtctcgatcctcc
F6XMC1_BCL2L11-07       -------------ctttgtgagaagatcctccgtgctgtctcgatcctcc
F6XMC1_BCL2L11-01       -------------ctttgtgagaagatcctccgtgctgtctcgatcctcc
F6XMC1_BCL2L11-02       --------------------------------------------------

F7FUT7_BIK-01           ------ttcgtcctcgaccggaccgacatcggggatgttcttagcggtgt
U3E722_HRK-01           ------------------ggcgccggc---------------------gc
F6SJL0_BAD-02           ----------------gggacggaggaggacgaagggatggaggaggagc
F6SJL0_BAD-01           ----------------gggacggaggaggacgaagggatggaggaggagc
F7HPK0_BMF-01           accggcttcatgtgcagcaacaccagcagaa-------------------
F7HPK0_BMF-02           --------------------caccagcagaa-------------------
A0A2R8MW85_BBC3-03      ------------------ggcggagacaagaggagcagccgcagcaccgc
F7GW45_PMAIP1-01        --------------tttggagacaaactgaa-----------------tt
F6XMC1_BCL2L11-09       -----------------------agacagga-----------------gc
F6XMC1_BCL2L11-06       agtgggtatttctcttttgacacagacagga-----------------gc
F6XMC1_BCL2L11-08       agtgggtatttctcttttgacacagacagga-----------------gc
F6XMC1_BCL2L11-04       agtgggtatttctcttttgacacagacagga-----------------gc
F6XMC1_BCL2L11-03       agtgggtatttctcttttgacacagacagga-----------------gc
F6XMC1_BCL2L11-05       agtgggtatttctcttttgacacagacagga-----------------gc
F6XMC1_BCL2L11-07       agtgggtatttctcttttgacacagacagga-----------------gc
F6XMC1_BCL2L11-01       agtgggtatttctcttttgacacagacagga-----------------gc
F6XMC1_BCL2L11-02       -----------------------agacagga-----------------gc

F7FUT7_BIK-01           cgtggatgttttcgctaacttccaggaggacatagtgaggctctggagat
U3E722_HRK-01           ccggcgcgct---------------------------------ccccacc
F6SJL0_BAD-02           ccagcccctt-------------------------t-------cggggcc
F6SJL0_BAD-01           ccagcccctt-------------------------t-------cggggcc
F7HPK0_BMF-01           -ccgaaatcg-------------------------catg----tggtggc
F7HPK0_BMF-02           -ccgaaatcg-------------------------catg----tggtggc
A0A2R8MW85_BBC3-03      ccctcgccct-------------------------ggagggtcctgtaca
F7GW45_PMAIP1-01        tccg----------------------------------g----cagaaac
F6XMC1_BCL2L11-09       ccagcaccca-------------------------tgag----ttgtgac
F6XMC1_BCL2L11-06       ccagcaccca-------------------------tgag----ttgtgac
F6XMC1_BCL2L11-08       ccagcaccca-------------------------tgag----ttgtgac
F6XMC1_BCL2L11-04       ccagcaccca-------------------------tgag----ttgtgac
F6XMC1_BCL2L11-03       ccagcaccca-------------------------tgag----ttgtgac
F6XMC1_BCL2L11-05       ccagcaccca-------------------------tgag----ttgtgac
F6XMC1_BCL2L11-07       ccagcaccca-------------------------tgag----ttgtgac
F6XMC1_BCL2L11-01       ccagcaccca-------------------------tgag----ttgtgac
F6XMC1_BCL2L11-02       ccagcaccca-------------------------tgag----ttgtgac

F7FUT7_BIK-01           ccctgagctccgggtcctgggtgtcccgcaaacagg--------------
U3E722_HRK-01           tactggccctgg---ctgtgcgcggccgc--gcagg-------tggcggc
F6SJL0_BAD-02           gttcgcgctcggcaccccccaacctctgg--gcag---------------
F6SJL0_BAD-01           gttcgcgctcggcaccccccaacctctgg--gcag---------------
F7HPK0_BMF-01           aggtcctcct-----------cttcctgc--acaacctggctttgaatgg
F7HPK0_BMF-02           aggtcctcct-----------cttcctgc--acaacctggctttgaatgg
A0A2R8MW85_BBC3-03      atctcatcatgggactcctgccct--ttc--ccagg-----------ggc
F7GW45_PMAIP1-01        ttctgaatctgatatccaaactcttctgc--tcagg--------------
F6XMC1_BCL2L11-09       aaatcaacacaaaccccaagtcctccttg--ccaggccttcaaccactat
F6XMC1_BCL2L11-06       aaatcaacacaaaccccaagtcctccttg--ccaggccttcaaccactat
F6XMC1_BCL2L11-08       aaatcaacacaaaccccaagtcctccttg--ccaggccttcaaccactat
F6XMC1_BCL2L11-04       aaatcaacacaaaccccaagtcctccttg--ccaggccttcaaccactat
F6XMC1_BCL2L11-03       aaatcaacacaaaccccaagtcctccttg--ccaggccttcaaccactat
F6XMC1_BCL2L11-05       aaatcaacacaaaccccaagtcctccttg--ccaggccttcaaccactat
F6XMC1_BCL2L11-07       aaatcaacacaaaccccaagtcctccttg--ccaggccttcaaccactat
F6XMC1_BCL2L11-01       aaatcaacacaaaccccaagtcctccttg--ccaggccttcaaccactat
F6XMC1_BCL2L11-02       aaatcaacacaaaccccaagtcctccttg--ccaggccttcaaccactat

F7FUT7_BIK-01           --cagtgctgctagcactcctggcgctgctgctggcgatgttcagtgggg
U3E722_HRK-01           gctggcggcctggctgctcggc----------aggcggaacttgtag---
F6SJL0_BAD-02           cacagcgctatgg-------------------ccgcgagctccggaggat
F6SJL0_BAD-01           cacagcgctatgg-------------------ccgcgagctccggaggat
F7HPK0_BMF-01           agaagagaacagg----------------aatggggcaggcccgaggtga
F7HPK0_BMF-02           agaagagaacagg----------------aatggggcaggcccgag----
A0A2R8MW85_BBC3-03      cacagagccccgg-------------------agatggagcccaattag-
F7GW45_PMAIP1-01        --------------------------------------aacctga-----
F6XMC1_BCL2L11-09       ctcagtgcaatggtagtcatccgaatggatataggtgatatttcattgtg
F6XMC1_BCL2L11-06       ctcagtgcaatggtt-----------------------------------
F6XMC1_BCL2L11-08       ctcagtgcaatgg--------------------gatacagactca-----
F6XMC1_BCL2L11-04       ctcagtgcaat---------------------------------------
F6XMC1_BCL2L11-03       ctcagtgcaatggcttccat-------------gaggcaatctca-----
F6XMC1_BCL2L11-05       ctcagtgcaatggcttccat-------------gaggcaatctca-----
F6XMC1_BCL2L11-07       ctcagtgcaatggcttccat-------------gaggcaatctca-----
F6XMC1_BCL2L11-01       ctcagtgcaatggcttccat-------------gaggcaatctca-----
F6XMC1_BCL2L11-02       ctcagtgcaatggcttccat-------------gaggcaatctca-----

F7FUT7_BIK-01           gtctgcacctgctgctcaagtga---------------------------
U3E722_HRK-01           --------------------------------------------------
F6SJL0_BAD-02           ga------------------------------------------------
F6SJL0_BAD-01           gagtgatgagtttgtggactcctttaagaagggacttcctcgcccgaaga
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
F6XMC1_BCL2L11-09       gtttagatttacatttaccttctttgatttgtgtggccaccaccacagtc
F6XMC1_BCL2L11-06       ------------------------agagaaataga------ggaagttgt
F6XMC1_BCL2L11-08       --------ctg---------gtcagcagccatgtctgccctggaaagtga
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       ggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgc
F6XMC1_BCL2L11-05       ggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgc
F6XMC1_BCL2L11-07       ggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgc
F6XMC1_BCL2L11-01       ggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgc
F6XMC1_BCL2L11-02       ggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgc

F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
F6SJL0_BAD-01           gcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtc
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
F6XMC1_BCL2L11-09       aaggtacagaacaacagcacaagg---atttctcatgg------------
F6XMC1_BCL2L11-06       cgtgtag-------------------------------------------
F6XMC1_BCL2L11-08       ggggcatcggggagaag----------------caggaagaacgt-----
F6XMC1_BCL2L11-04       ---------------------------------------gggtat-----
F6XMC1_BCL2L11-03       ggcgtatcggagacgagtttaacgcttattatccaaggagggtat-----
F6XMC1_BCL2L11-05       ggcgtatcggagacgagtttaacgcttattatccaaggaggatat-----
F6XMC1_BCL2L11-07       ggcgtatcggagacgagtttaacgcttattatccaaggaggttag-----
F6XMC1_BCL2L11-01       ggcgtatcggagacgagtttaacgcttattatccaaggagggtaaactgg
F6XMC1_BCL2L11-02       ggcgtatcggagacgagtttaacgcttattatccaaggagggtaaactgg

F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
F6SJL0_BAD-01           atccagtcctggtgggataggaacttgggcaggggaggctccgctccttc
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
F6XMC1_BCL2L11-08       ---------------------------gtgaacccacacacatgggagac
F6XMC1_BCL2L11-04       --------------------------------ttttgaataa--------
F6XMC1_BCL2L11-03       --------------------------------ttttgaataattaccaag
F6XMC1_BCL2L11-05       ------ctcttctacct---------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
F6XMC1_BCL2L11-01       atactgcccttttgccatcggaaggaagtgtgtcttgaagcattcccggt
F6XMC1_BCL2L11-02       atactgcccttttgccatcggaaggaagtgtgtcttgaagcattcccggt

F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
F6SJL0_BAD-01           ccagtga-------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
F6XMC1_BCL2L11-08       cttcaaaagcaccagaactcacagtctttcagcacgtaattctatacatc
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       cagctgaagaccacccacacatggttatcttacgactgttacgttacatt
F6XMC1_BCL2L11-05       ----------------------------------------------gatt
F6XMC1_BCL2L11-07       -------------------------------------------agaaata
F6XMC1_BCL2L11-01       tttaccatcgaaagccagccagagtgcttactggaccacaatcagagatc
F6XMC1_BCL2L11-02       tttaccatcgaaagccagccagagtgcttactggaccacaatcagagatc

F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
F6XMC1_BCL2L11-08       cttaa---------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       gtccgcctggtgtggagaatgcattga-----------------------
F6XMC1_BCL2L11-05       g-------------------------------------------------
F6XMC1_BCL2L11-07       g-------------------------------------------------
F6XMC1_BCL2L11-01       gttcaatcaatacttgctgtgccaaagcccaaagaattatttctggtaat
F6XMC1_BCL2L11-02       gttcaatcaatacttgctgtgccaaagcccaaagaattatttctggtaat

F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
F6XMC1_BCL2L11-01       attctccaatctgtggccagatggtgccaaatgatgttgaccccacagct
F6XMC1_BCL2L11-02       attctccaatctgtggccagatggtgccaaatgatgttgaccccacagct

F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
F6XMC1_BCL2L11-01       gtacttggttctcaaggacggtggccccgtggtcaaatctgctttaaaac
F6XMC1_BCL2L11-02       gtacttggttctcaaggacggtggccccgtggtcaaatctgctttaaaac

F7FUT7_BIK-01           -----------------------------
U3E722_HRK-01           -----------------------------
F6SJL0_BAD-02           -----------------------------
F6SJL0_BAD-01           -----------------------------
F7HPK0_BMF-01           -----------------------------
F7HPK0_BMF-02           -----------------------------
A0A2R8MW85_BBC3-03      -----------------------------
F7GW45_PMAIP1-01        -----------------------------
F6XMC1_BCL2L11-09       -----------------------------
F6XMC1_BCL2L11-06       -----------------------------
F6XMC1_BCL2L11-08       -----------------------------
F6XMC1_BCL2L11-04       -----------------------------
F6XMC1_BCL2L11-03       -----------------------------
F6XMC1_BCL2L11-05       ----------------------------a
F6XMC1_BCL2L11-07       -----------------------------
F6XMC1_BCL2L11-01       tgccatggttccactctccagtggcatga
F6XMC1_BCL2L11-02       tgccatggttccactctccagtggcatga

© 1998-2019