Dataset for CDS BMF of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7HPK0_BMF-02      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggg
F7HPK0_BMF-01      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggg
                   ************************************************************

F7HPK0_BMF-02      gagccagggacccaacccgggagcttgctctctgctgacctatttgcccagagcctactg
F7HPK0_BMF-01      gagccagggacccaacccgggagcttgctctctgctgacctatttgcccagagcctactg
                   ************************************************************

F7HPK0_BMF-02      gactgccccctcagtcggcttcagctcttccctctcacccactgctgtggccctggcctt
F7HPK0_BMF-01      gactgccccctcagtcggcttcagctcttccctctcacccactgctgtggccctggcctt
                   ************************************************************

F7HPK0_BMF-02      cgacccaccagccaggaagacaaggctacccagaccctcagcccagcctcccccagccaa
F7HPK0_BMF-01      cgacccaccagccaggaagacaaggctacccagaccctcagcccagcctcccccagccaa
                   ************************************************************

F7HPK0_BMF-02      ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttacg--------
F7HPK0_BMF-01      ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttacggcaatgct
                   ****************************************************        

F7HPK0_BMF-02      ------------------------------------------------------------
F7HPK0_BMF-01      ggctaccggcttcctctccctgccagtttcccggcagtcttgccccttggggagcagccc
                                                                               

F7HPK0_BMF-02      ------------------------------------------------------------
F7HPK0_BMF-01      cccgaagggcagtggcaacatcgagcagaggtacagattgcccgaaagcttcagtgcatt
                                                                               

F7HPK0_BMF-02      ---------------------------------caccagcagaaccgaaatcgcatgtgg
F7HPK0_BMF-01      gcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatcgcatgtgg
                                                    ***************************

F7HPK0_BMF-02      tggcaggtcctcctcttcctgcacaacctggctttgaatggagaagagaacaggaatggg
F7HPK0_BMF-01      tggcaggtcctcctcttcctgcacaacctggctttgaatggagaagagaacaggaatggg
                   ************************************************************

F7HPK0_BMF-02      gcaggcccgag----
F7HPK0_BMF-01      gcaggcccgaggtga
                   ***********    

© 1998-2019