Dataset for CDS BCL2L11 of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F6XMC1_BCL2L11-09      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
F6XMC1_BCL2L11-06      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
F6XMC1_BCL2L11-08      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
F6XMC1_BCL2L11-04      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
F6XMC1_BCL2L11-03      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
F6XMC1_BCL2L11-05      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
F6XMC1_BCL2L11-07      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
F6XMC1_BCL2L11-01      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
F6XMC1_BCL2L11-02      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag

F6XMC1_BCL2L11-09      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
F6XMC1_BCL2L11-06      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
F6XMC1_BCL2L11-08      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
F6XMC1_BCL2L11-04      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
F6XMC1_BCL2L11-03      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
F6XMC1_BCL2L11-05      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
F6XMC1_BCL2L11-07      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
F6XMC1_BCL2L11-01      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
F6XMC1_BCL2L11-02      acaattgcagcctgcggagagacctccccagctcagacctggggccccta

F6XMC1_BCL2L11-09      cctccctacagacagagccaca----------------------------
F6XMC1_BCL2L11-06      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F6XMC1_BCL2L11-08      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F6XMC1_BCL2L11-04      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F6XMC1_BCL2L11-03      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F6XMC1_BCL2L11-05      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F6XMC1_BCL2L11-07      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F6XMC1_BCL2L11-01      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F6XMC1_BCL2L11-02      cctccctacagacagagccaca----------------------------

F6XMC1_BCL2L11-09      --------------------------------------------------
F6XMC1_BCL2L11-06      gaaggggacagctgcctccacggcagccctcagggcccgctggccccacc
F6XMC1_BCL2L11-08      gaaggggacagctgcctccacggcagccctcagggcccgctggccccacc
F6XMC1_BCL2L11-04      gaaggggacagctgcctccacggcagccctcagggcccgctggccccacc
F6XMC1_BCL2L11-03      gaaggggacagctgcctccacggcagccctcagggcccgctggccccacc
F6XMC1_BCL2L11-05      gaaggggacagctgcctccacggcagccctcagggcccgctggccccacc
F6XMC1_BCL2L11-07      gaaggggacagctgcctccacggcagccctcagggcccgctggccccacc
F6XMC1_BCL2L11-01      gaaggggacagctgcctccacggcagccctcagggcccgctggccccacc
F6XMC1_BCL2L11-02      --------------------------------------------------

F6XMC1_BCL2L11-09      --------------------------------------------------
F6XMC1_BCL2L11-06      ggccagccccggcccttttgctaccagatccccgcttttcatctttgtga
F6XMC1_BCL2L11-08      ggccagccccggcccttttgctaccagatccccgcttttcatctttgtga
F6XMC1_BCL2L11-04      ggccagccccggcccttttgctaccagatccccgcttttcatctttgtga
F6XMC1_BCL2L11-03      ggccagccccggcccttttgctaccagatccccgcttttcatctttgtga
F6XMC1_BCL2L11-05      ggccagccccggcccttttgctaccagatccccgcttttcatctttgtga
F6XMC1_BCL2L11-07      ggccagccccggcccttttgctaccagatccccgcttttcatctttgtga
F6XMC1_BCL2L11-01      ggccagccccggcccttttgctaccagatccccgcttttcatctttgtga
F6XMC1_BCL2L11-02      --------------------------------------------------

F6XMC1_BCL2L11-09      --------------------------------------------------
F6XMC1_BCL2L11-06      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
F6XMC1_BCL2L11-08      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
F6XMC1_BCL2L11-04      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
F6XMC1_BCL2L11-03      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
F6XMC1_BCL2L11-05      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
F6XMC1_BCL2L11-07      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
F6XMC1_BCL2L11-01      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
F6XMC1_BCL2L11-02      --------------------------------------------------

F6XMC1_BCL2L11-09      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
F6XMC1_BCL2L11-06      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
F6XMC1_BCL2L11-08      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
F6XMC1_BCL2L11-04      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
F6XMC1_BCL2L11-03      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
F6XMC1_BCL2L11-05      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
F6XMC1_BCL2L11-07      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
F6XMC1_BCL2L11-01      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
F6XMC1_BCL2L11-02      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc

F6XMC1_BCL2L11-09      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtca
F6XMC1_BCL2L11-06      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtt----
F6XMC1_BCL2L11-08      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg------
F6XMC1_BCL2L11-04      aagtcctccttgccaggccttcaaccactatctcagtgcaat--------
F6XMC1_BCL2L11-03      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
F6XMC1_BCL2L11-05      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
F6XMC1_BCL2L11-07      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
F6XMC1_BCL2L11-01      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
F6XMC1_BCL2L11-02      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca

F6XMC1_BCL2L11-09      tccgaatggatataggtgatatttcattgtggtttagatttacatttacc
F6XMC1_BCL2L11-06      --------------------------------------------------
F6XMC1_BCL2L11-08      --------------gatacagactca-------------ctg--------
F6XMC1_BCL2L11-04      --------------------------------------------------
F6XMC1_BCL2L11-03      t-------------gaggcaatctca-----ggctgaacctgcaggtatg
F6XMC1_BCL2L11-05      t-------------gaggcaatctca-----ggctgaacctgcaggtatg
F6XMC1_BCL2L11-07      t-------------gaggcaatctca-----ggctgaacctgcaggtatg
F6XMC1_BCL2L11-01      t-------------gaggcaatctca-----ggctgaacctgcaggtatg
F6XMC1_BCL2L11-02      t-------------gaggcaatctca-----ggctgaacctgcaggtatg

F6XMC1_BCL2L11-09      ttctttgatttgtgtggccaccaccacagtcaaggtacagaacaacagca
F6XMC1_BCL2L11-06      -----agagaaataga------ggaagttgtcgtgtag------------
F6XMC1_BCL2L11-08      -gtcagcagccatgtctgccctggaaagtgaggggcatcggggagaag--
F6XMC1_BCL2L11-04      --------------------------------------------------
F6XMC1_BCL2L11-03      cgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtt
F6XMC1_BCL2L11-05      cgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtt
F6XMC1_BCL2L11-07      cgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtt
F6XMC1_BCL2L11-01      cgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtt
F6XMC1_BCL2L11-02      cgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtt

F6XMC1_BCL2L11-09      caagg---atttctcatgg-------------------------------
F6XMC1_BCL2L11-06      --------------------------------------------------
F6XMC1_BCL2L11-08      --------------caggaagaacgt------------------------
F6XMC1_BCL2L11-04      --------------------gggtat------------------------
F6XMC1_BCL2L11-03      taacgcttattatccaaggagggtat------------------------
F6XMC1_BCL2L11-05      taacgcttattatccaaggaggatat-----------ctcttctacct--
F6XMC1_BCL2L11-07      taacgcttattatccaaggaggttag------------------------
F6XMC1_BCL2L11-01      taacgcttattatccaaggagggtaaactggatactgcccttttgccatc
F6XMC1_BCL2L11-02      taacgcttattatccaaggagggtaaactggatactgcccttttgccatc

F6XMC1_BCL2L11-09      --------------------------------------------------
F6XMC1_BCL2L11-06      --------------------------------------------------
F6XMC1_BCL2L11-08      --------gtgaacccacacacatgggagaccttcaaaagcaccagaact
F6XMC1_BCL2L11-04      -------------ttttgaataa---------------------------
F6XMC1_BCL2L11-03      -------------ttttgaataattaccaagcagctgaagaccacccaca
F6XMC1_BCL2L11-05      --------------------------------------------------
F6XMC1_BCL2L11-07      --------------------------------------------------
F6XMC1_BCL2L11-01      ggaaggaagtgtgtcttgaagcattcccggttttaccatcgaaagccagc
F6XMC1_BCL2L11-02      ggaaggaagtgtgtcttgaagcattcccggttttaccatcgaaagccagc

F6XMC1_BCL2L11-09      --------------------------------------------------
F6XMC1_BCL2L11-06      --------------------------------------------------
F6XMC1_BCL2L11-08      cacagtctttcagcacgtaattctatacatccttaa--------------
F6XMC1_BCL2L11-04      --------------------------------------------------
F6XMC1_BCL2L11-03      catggttatcttacgactgttacgttacattgtccgcctggtgtggagaa
F6XMC1_BCL2L11-05      ---------------------------gattg------------------
F6XMC1_BCL2L11-07      ------------------------agaaatag------------------
F6XMC1_BCL2L11-01      cagagtgcttactggaccacaatcagagatcgttcaatcaatacttgctg
F6XMC1_BCL2L11-02      cagagtgcttactggaccacaatcagagatcgttcaatcaatacttgctg

F6XMC1_BCL2L11-09      --------------------------------------------------
F6XMC1_BCL2L11-06      --------------------------------------------------
F6XMC1_BCL2L11-08      --------------------------------------------------
F6XMC1_BCL2L11-04      --------------------------------------------------
F6XMC1_BCL2L11-03      tgcattga------------------------------------------
F6XMC1_BCL2L11-05      --------------------------------------------------
F6XMC1_BCL2L11-07      --------------------------------------------------
F6XMC1_BCL2L11-01      tgccaaagcccaaagaattatttctggtaatattctccaatctgtggcca
F6XMC1_BCL2L11-02      tgccaaagcccaaagaattatttctggtaatattctccaatctgtggcca

F6XMC1_BCL2L11-09      --------------------------------------------------
F6XMC1_BCL2L11-06      --------------------------------------------------
F6XMC1_BCL2L11-08      --------------------------------------------------
F6XMC1_BCL2L11-04      --------------------------------------------------
F6XMC1_BCL2L11-03      --------------------------------------------------
F6XMC1_BCL2L11-05      --------------------------------------------------
F6XMC1_BCL2L11-07      --------------------------------------------------
F6XMC1_BCL2L11-01      gatggtgccaaatgatgttgaccccacagctgtacttggttctcaaggac
F6XMC1_BCL2L11-02      gatggtgccaaatgatgttgaccccacagctgtacttggttctcaaggac

F6XMC1_BCL2L11-09      --------------------------------------------------
F6XMC1_BCL2L11-06      --------------------------------------------------
F6XMC1_BCL2L11-08      --------------------------------------------------
F6XMC1_BCL2L11-04      --------------------------------------------------
F6XMC1_BCL2L11-03      --------------------------------------------------
F6XMC1_BCL2L11-05      --------------------------------------------------
F6XMC1_BCL2L11-07      --------------------------------------------------
F6XMC1_BCL2L11-01      ggtggccccgtggtcaaatctgctttaaaactgccatggttccactctcc
F6XMC1_BCL2L11-02      ggtggccccgtggtcaaatctgctttaaaactgccatggttccactctcc

F6XMC1_BCL2L11-09      ----------
F6XMC1_BCL2L11-06      ----------
F6XMC1_BCL2L11-08      ----------
F6XMC1_BCL2L11-04      ----------
F6XMC1_BCL2L11-03      ----------
F6XMC1_BCL2L11-05      ---------a
F6XMC1_BCL2L11-07      ----------
F6XMC1_BCL2L11-01      agtggcatga
F6XMC1_BCL2L11-02      agtggcatga

© 1998-2019