Dataset for CDS BCL2L11 of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6XMC1_BCL2L11-09      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
F6XMC1_BCL2L11-02      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
F6XMC1_BCL2L11-01      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
F6XMC1_BCL2L11-06      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
F6XMC1_BCL2L11-08      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
F6XMC1_BCL2L11-03      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
F6XMC1_BCL2L11-04      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
F6XMC1_BCL2L11-05      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
F6XMC1_BCL2L11-07      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
                       **************************************************

F6XMC1_BCL2L11-09      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
F6XMC1_BCL2L11-02      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
F6XMC1_BCL2L11-01      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
F6XMC1_BCL2L11-06      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
F6XMC1_BCL2L11-08      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
F6XMC1_BCL2L11-03      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
F6XMC1_BCL2L11-04      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
F6XMC1_BCL2L11-05      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
F6XMC1_BCL2L11-07      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
                       **************************************************

F6XMC1_BCL2L11-09      cctccctacagacagagccaca----------------------------
F6XMC1_BCL2L11-02      cctccctacagacagagccaca----------------------------
F6XMC1_BCL2L11-01      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F6XMC1_BCL2L11-06      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F6XMC1_BCL2L11-08      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F6XMC1_BCL2L11-03      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F6XMC1_BCL2L11-04      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F6XMC1_BCL2L11-05      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
F6XMC1_BCL2L11-07      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
                       **********************                            

F6XMC1_BCL2L11-09      --------------------------------------------------
F6XMC1_BCL2L11-02      --------------------------------------------------
F6XMC1_BCL2L11-01      gaaggggacagctgcctccacggcagccctcagggcccgctggccccacc
F6XMC1_BCL2L11-06      gaaggggacagctgcctccacggcagccctcagggcccgctggccccacc
F6XMC1_BCL2L11-08      gaaggggacagctgcctccacggcagccctcagggcccgctggccccacc
F6XMC1_BCL2L11-03      gaaggggacagctgcctccacggcagccctcagggcccgctggccccacc
F6XMC1_BCL2L11-04      gaaggggacagctgcctccacggcagccctcagggcccgctggccccacc
F6XMC1_BCL2L11-05      gaaggggacagctgcctccacggcagccctcagggcccgctggccccacc
F6XMC1_BCL2L11-07      gaaggggacagctgcctccacggcagccctcagggcccgctggccccacc
                                                                         

F6XMC1_BCL2L11-09      --------------------------------------------------
F6XMC1_BCL2L11-02      --------------------------------------------------
F6XMC1_BCL2L11-01      ggccagccccggcccttttgctaccagatccccgcttttcatctttgtga
F6XMC1_BCL2L11-06      ggccagccccggcccttttgctaccagatccccgcttttcatctttgtga
F6XMC1_BCL2L11-08      ggccagccccggcccttttgctaccagatccccgcttttcatctttgtga
F6XMC1_BCL2L11-03      ggccagccccggcccttttgctaccagatccccgcttttcatctttgtga
F6XMC1_BCL2L11-04      ggccagccccggcccttttgctaccagatccccgcttttcatctttgtga
F6XMC1_BCL2L11-05      ggccagccccggcccttttgctaccagatccccgcttttcatctttgtga
F6XMC1_BCL2L11-07      ggccagccccggcccttttgctaccagatccccgcttttcatctttgtga
                                                                         

F6XMC1_BCL2L11-09      --------------------------------------------------
F6XMC1_BCL2L11-02      --------------------------------------------------
F6XMC1_BCL2L11-01      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
F6XMC1_BCL2L11-06      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
F6XMC1_BCL2L11-08      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
F6XMC1_BCL2L11-03      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
F6XMC1_BCL2L11-04      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
F6XMC1_BCL2L11-05      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
F6XMC1_BCL2L11-07      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
                                                                         

F6XMC1_BCL2L11-09      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
F6XMC1_BCL2L11-02      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
F6XMC1_BCL2L11-01      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
F6XMC1_BCL2L11-06      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
F6XMC1_BCL2L11-08      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
F6XMC1_BCL2L11-03      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
F6XMC1_BCL2L11-04      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
F6XMC1_BCL2L11-05      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
F6XMC1_BCL2L11-07      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                         ************************************************

F6XMC1_BCL2L11-09      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtca
F6XMC1_BCL2L11-02      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
F6XMC1_BCL2L11-01      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
F6XMC1_BCL2L11-06      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtt----
F6XMC1_BCL2L11-08      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg------
F6XMC1_BCL2L11-03      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
F6XMC1_BCL2L11-04      aagtcctccttgccaggccttcaaccactatctcagtgcaat--------
F6XMC1_BCL2L11-05      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
F6XMC1_BCL2L11-07      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
                       ******************************************        

F6XMC1_BCL2L11-09      tccgaatggatataggtgatatttcattgtggtttagatttacatttacc
F6XMC1_BCL2L11-02      t-------------gaggcaatctca-gg----ctgaacctgcaggtatg
F6XMC1_BCL2L11-01      t-------------gaggcaatctca-gg----ctgaacctgcaggtatg
F6XMC1_BCL2L11-06      --------------------------------------------------
F6XMC1_BCL2L11-08      --------------gatacagactcactg----gtcagcagccatgtctg
F6XMC1_BCL2L11-03      t-------------gaggcaatctca-gg----ctgaacctgcaggtatg
F6XMC1_BCL2L11-04      --------------------------------------------------
F6XMC1_BCL2L11-05      t-------------gaggcaatctca-gg----ctgaacctgcaggtatg
F6XMC1_BCL2L11-07      t-------------gaggcaatctca-gg----ctgaacctgcaggtatg
                                                                         

F6XMC1_BCL2L11-09      ttctttgatttgtgtggccaccaccacagtcaa-----------------
F6XMC1_BCL2L11-02      cgcccggagatatggatcgcccaagagttgcgg-----------------
F6XMC1_BCL2L11-01      cgcccggagatatggatcgcccaagagttgcgg-----------------
F6XMC1_BCL2L11-06      -----------------------agagaaatag-----------------
F6XMC1_BCL2L11-08      ccctggaaagtgaggggcatcggggagaagcaggaagaacgtgtgaaccc
F6XMC1_BCL2L11-03      cgcccggagatatggatcgcccaagagttgcgg-----------------
F6XMC1_BCL2L11-04      --------------------------------------------------
F6XMC1_BCL2L11-05      cgcccggagatatggatcgcccaagagttgcgg-----------------
F6XMC1_BCL2L11-07      cgcccggagatatggatcgcccaagagttgcgg-----------------
                                                                         

F6XMC1_BCL2L11-09      ---ggtacagaacaa---------cagcacaagg---atttctcatgg--
F6XMC1_BCL2L11-02      ---cgtatcggagac---------gagtttaacgcttattatccaaggag
F6XMC1_BCL2L11-01      ---cgtatcggagac---------gagtttaacgcttattatccaaggag
F6XMC1_BCL2L11-06      ---------------------------------------------aggaa
F6XMC1_BCL2L11-08      acacacatgggagaccttcaaaagcaccagaactcacagtctttcagcac
F6XMC1_BCL2L11-03      ---cgtatcggagac---------gagtttaacgcttattatccaaggag
F6XMC1_BCL2L11-04      -------------------------------------------------g
F6XMC1_BCL2L11-05      ---cgtatcggagac---------gagtttaacgcttattatccaaggag
F6XMC1_BCL2L11-07      ---cgtatcggagac---------gagtttaacgcttattatccaaggag
                                                                         

F6XMC1_BCL2L11-09      --------------------------------------------------
F6XMC1_BCL2L11-02      ggtaaactggatactgcccttttgccatcggaaggaagtgtgtcttgaag
F6XMC1_BCL2L11-01      ggtaaactggatactgcccttttgccatcggaaggaagtgtgtcttgaag
F6XMC1_BCL2L11-06      gttgtcgtg-----------------------------------------
F6XMC1_BCL2L11-08      gtaattcta--ta-------------------------------------
F6XMC1_BCL2L11-03      ggtattttt-----------------------------------------
F6XMC1_BCL2L11-04      ggtattttt-----------------------------------------
F6XMC1_BCL2L11-05      gatatctcttcta-------------------------------------
F6XMC1_BCL2L11-07      g---------tta-------------------------------------
                                                                         

F6XMC1_BCL2L11-09      --------------------------------------------------
F6XMC1_BCL2L11-02      cattcccggttttaccatcgaaagccagccagagtgcttactggaccaca
F6XMC1_BCL2L11-01      cattcccggttttaccatcgaaagccagccagagtgcttactggaccaca
F6XMC1_BCL2L11-06      --------------------------------------------------
F6XMC1_BCL2L11-08      ----------------------------------------------catc
F6XMC1_BCL2L11-03      -------------------------------------------------g
F6XMC1_BCL2L11-04      -------------------------------------------------g
F6XMC1_BCL2L11-05      ----------------------------------------------cctg
F6XMC1_BCL2L11-07      ----------------------------------------------gaga
                                                                         

F6XMC1_BCL2L11-09      --------------------------------------------------
F6XMC1_BCL2L11-02      atcagagatcgttcaatcaatacttgctgtgccaaagcccaaagaattat
F6XMC1_BCL2L11-01      atcagagatcgttcaatcaatacttgctgtgccaaagcccaaagaattat
F6XMC1_BCL2L11-06      --tag---------------------------------------------
F6XMC1_BCL2L11-08      cttaa---------------------------------------------
F6XMC1_BCL2L11-03      aataattaccaagcagctgaagaccacccacacatggttatcttacgact
F6XMC1_BCL2L11-04      aataa---------------------------------------------
F6XMC1_BCL2L11-05      attga---------------------------------------------
F6XMC1_BCL2L11-07      aatag---------------------------------------------
                                                                         

F6XMC1_BCL2L11-09      --------------------------------------------------
F6XMC1_BCL2L11-02      ttctggtaatattctccaatctgtggccagatggtgccaaatgatgttga
F6XMC1_BCL2L11-01      ttctggtaatattctccaatctgtggccagatggtgccaaatgatgttga
F6XMC1_BCL2L11-06      --------------------------------------------------
F6XMC1_BCL2L11-08      --------------------------------------------------
F6XMC1_BCL2L11-03      gttacgttacattgtccgcctggtgtggagaatgcattga----------
F6XMC1_BCL2L11-04      --------------------------------------------------
F6XMC1_BCL2L11-05      --------------------------------------------------
F6XMC1_BCL2L11-07      --------------------------------------------------
                                                                         

F6XMC1_BCL2L11-09      --------------------------------------------------
F6XMC1_BCL2L11-02      ccccacagctgtacttggttctcaaggacggtggccccgtggtcaaatct
F6XMC1_BCL2L11-01      ccccacagctgtacttggttctcaaggacggtggccccgtggtcaaatct
F6XMC1_BCL2L11-06      --------------------------------------------------
F6XMC1_BCL2L11-08      --------------------------------------------------
F6XMC1_BCL2L11-03      --------------------------------------------------
F6XMC1_BCL2L11-04      --------------------------------------------------
F6XMC1_BCL2L11-05      --------------------------------------------------
F6XMC1_BCL2L11-07      --------------------------------------------------
                                                                         

F6XMC1_BCL2L11-09      ---------------------------------------
F6XMC1_BCL2L11-02      gctttaaaactgccatggttccactctccagtggcatga
F6XMC1_BCL2L11-01      gctttaaaactgccatggttccactctccagtggcatga
F6XMC1_BCL2L11-06      ---------------------------------------
F6XMC1_BCL2L11-08      ---------------------------------------
F6XMC1_BCL2L11-03      ---------------------------------------
F6XMC1_BCL2L11-04      ---------------------------------------
F6XMC1_BCL2L11-05      ---------------------------------------
F6XMC1_BCL2L11-07      ---------------------------------------
                                                              

© 1998-2019