Dataset for CDS BBC3 of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2R8MW85_BBC3-03      atgaaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcccag
A0A2R8MW85_BBC3-01      atgaaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcccag
                        **************************************************

A0A2R8MW85_BBC3-03      ggcttcttcctcggtgtgggtcccctgccagatgtgt-------------
A0A2R8MW85_BBC3-01      ggcttcttcctcggtgtgggtcccctgccagatgtgtggccccagggagc
                        *************************************             

A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      gccatggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
                                                                          

A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      cttggcccgcgacggcccgcgccccttcccgcttggccgcctggtgccct
                                                                          

A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      cggccgtgtcctgcggcctctgcgagtccggcctgcccgccacccccgcc
                                                                          

A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      gcccccgccttgctgcccgctgcctacctctgcgcccccgccgccccacc
                                                                          

A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      cgccgtcaccgccgccctggggggcccccgctggcctgggggcccccgca
                                                                          

A0A2R8MW85_BBC3-03      --------------------------ggtcctcagccctcgctctcgctg
A0A2R8MW85_BBC3-01      gccgcccccgaggcccgcgcccggacggtcctcagccctcgctctcgctg
                                                  ************************

A0A2R8MW85_BBC3-03      gcggagcagcacctggagtcgcccgtgcccagcgccccaggggccctggc
A0A2R8MW85_BBC3-01      gcggagcagcacctggagtcgcccgtgcccagcgccccaggggccctggc
                        **************************************************

A0A2R8MW85_BBC3-03      gggcggtcccacccaggcggcccccggagtccgcggggaggaggagcagt
A0A2R8MW85_BBC3-01      gggcggtcccacccaggcggcccccggagtccgcggggaggaggagcagt
                        **************************************************

A0A2R8MW85_BBC3-03      gggcccgggagatcggggcccagctgcgacggatggcggacgacctcaac
A0A2R8MW85_BBC3-01      gggcccgggagatcggggcccagctgcgacggatggcggacgacctcaac
                        **************************************************

A0A2R8MW85_BBC3-03      gcgctgtacgagcggcggagacaagaggagcagccgcagcaccgcccctc
A0A2R8MW85_BBC3-01      gcgctgtacgagcggcggagacaagaggagcagccgcagcaccgcccctc
                        **************************************************

A0A2R8MW85_BBC3-03      gccctggagggtcctgtacaatctcatcatgggactcctgccctttccca
A0A2R8MW85_BBC3-01      gccctggagggtcctgtacaatctcatcatgggactcctgccctttccca
                        **************************************************

A0A2R8MW85_BBC3-03      ggggccacagagccccggagatggagcccaattag---------------
A0A2R8MW85_BBC3-01      ggggccacagagccccggagatggagcccaattaggtgcctgcacccgcc
                        ***********************************               

A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      cggtggacgtcagggacttggggggcaggcccctcccatctcctgacacc
                                                                          

A0A2R8MW85_BBC3-03      ------------------------------------
A0A2R8MW85_BBC3-01      ctggccagcgcgggggactttctctgcaccatgtag
                                                            

© 1998-2018